G488303


Basic Information

Item Value
gene id G488303
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 2778578 ~ 2780461 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU560247
CTGGGCATTGTGCAGGTGGTTCTTGTTCTGATTTTGTAGCAAAGCTCTCTCATATTTGTCCTGCCAGGTTTGGTTGTTGGCCTCCATGCGAGCTCGTAGCTCAGTCATTTCCAGCCTCAGCTGCTTGTTCTCCTCCTTCAAAATGTTCAGAGATGACACGTAGCTGTCTCTAAGACTCGCCAGCTCTCCGTCACCCCTCTTAGACGATCTTGACTCGACTCTCTCAAGAAGATCATTTAGATGCTGATTCTCAAGCTTTAGAGTTTCAAGCTGGACCTGTGTCACCTTGAGTTCTGATGCCCGGCGCTCTGCTCGCTCCACTTCTGCCCGTAGCTGTCGCTCGATACTAGAGGCGGAGCCAGTGAGTGTGGCAATGGTGATGTCACGTTGATGAAGTTCACTGGTTAACTGAGACACCTCCTTCCTCATTCCCTCCAACTCTCCACAGCGAGTCTGTTCGGCCCTCTCAAGCTCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU560247 True 476 lncRNA 0.51 3 2778578 2780461

Neighbor

gene id symbol gene type direction distance location
CI01000340_02567081_02567521 NA coding downstream 210935 2566737 ~ 2567643 (-)
CI01000340_02341068_02348409 NA coding downstream 430101 2340503 ~ 2348477 (-)
CI01000340_02333476_02337529 AGXTA coding downstream 441049 2333102 ~ 2337529 (-)
CI01000340_02329631_02332000 DTYMK coding downstream 446578 2329606 ~ 2332000 (-)
CI01000340_02293072_02301920 STK25B, STK25, STK25A coding downstream 475631 2293014 ~ 2302947 (-)
CI01000340_02936853_02939837 BCL6A, BCL6 coding upstream 155176 2935637 ~ 2939837 (-)
CI01000340_03342324_03363204 TOMM70, TOMM70A coding upstream 561840 3342301 ~ 3363619 (-)
CI01000340_03379959_03401892 GFI1AB, GFI1 coding upstream 598825 3379286 ~ 3401952 (-)
CI01000340_03403238_03403692 NA coding upstream 622762 3403223 ~ 3403692 (-)
CI01000340_03406706_03449487 EVI5 coding upstream 626013 3406474 ~ 3449487 (-)
G488306 NA non-coding downstream 5161 2767168 ~ 2773417 (-)
G488276 NA non-coding downstream 9262 2702401 ~ 2769316 (-)
G488259 NA non-coding downstream 26612 2658651 ~ 2751966 (-)
G488251 NA non-coding downstream 123923 2648354 ~ 2654655 (-)
G488247 NA non-coding downstream 144761 2633573 ~ 2633817 (-)
G488302 NA non-coding upstream 1052 2781513 ~ 2783739 (-)
G488304 NA non-coding upstream 5206 2785667 ~ 2786091 (-)
G488325 NA non-coding upstream 25552 2806013 ~ 2806242 (-)
G488346 NA non-coding upstream 52522 2832983 ~ 2833205 (-)
G488359 NA non-coding upstream 74798 2855259 ~ 2858243 (-)
G487884 NA other downstream 876306 1895801 ~ 1902272 (-)
CI01000340_00787534_00791061 NA other downstream 1987169 786551 ~ 791409 (-)
G485786 NA other downstream 2452862 325334 ~ 325716 (-)
CI01000340_00062787_00080635 NA other downstream 2696483 62780 ~ 82095 (-)
G488782 NA other upstream 1225344 4005805 ~ 4006448 (-)
G488862 NA other upstream 1726735 4507196 ~ 4518120 (-)
CI01000340_04598932_04627160 NA other upstream 1819759 4598714 ~ 4627447 (-)
CI01000340_05321995_05329778 ATG4C other upstream 2540292 5320753 ~ 5330215 (-)
CI01000340_06095704_06194498 MAST2 other upstream 3402829 6095704 ~ 6194501 (-)

Expression


Co-expression Network