G486858


Basic Information

Item Value
gene id G486858
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 2964295 ~ 2964607 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU558629
GCAACATGATTGGGTATAAAAAGAGCCTCTCAGAGTGGCAGTGTCTCTCAGAAGTCAAGATGGGCAGAGGATAACCAATTCCCCCAATGCTGCGGCGAAAAATAGTGGAGCAATATCAGAAAGGAGTTTCTCAGAGAAAAATAGCAAAGAGTTTGAAGTTATCATCATATACAGTGCATAATATCATCCAAAGATTCAGAGAATCTGGAACAATCTCTGTGCGTAAGGGTCAAGGCCGGAAAACCTTACTGGATGCCCGTGATCTTCGGGCCCTTAGATGGCACTGCATCACATACAGGAATGCTACTGTAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU558629 True 313 lncRNA 0.44 1 2964295 2964607

Neighbor

gene id symbol gene type direction distance location
CI01000340_02930635_02933799 LSM2 coding upstream 30405 2930635 ~ 2933935 (+)
CI01000340_02911658_02928746 INPP5D coding upstream 34951 2910973 ~ 2929344 (+)
CI01000340_02905987_02907006 GPR17 coding upstream 57221 2905128 ~ 2907074 (+)
CI01000340_02870871_02899752 NA coding upstream 64284 2870871 ~ 2900011 (+)
CI01000340_02846209_02868305 SAP130A coding upstream 95436 2846209 ~ 2868859 (+)
CI01000340_03053157_03201683 LPP coding downstream 88550 3053157 ~ 3201683 (+)
CI01000340_03242647_03264271 NA coding downstream 278040 3242647 ~ 3264850 (+)
CI01000340_03291151_03315214 NA coding downstream 326040 3290647 ~ 3315757 (+)
CI01000340_03320562_03329314 TP63 coding downstream 355862 3320469 ~ 3329682 (+)
CI01000340_03370316_03378878 NA coding downstream 405668 3370275 ~ 3379000 (+)
G486927 NA non-coding upstream 53753 2910261 ~ 2910542 (+)
G486913 NA non-coding upstream 68464 2841712 ~ 2895831 (+)
G486904 NA non-coding upstream 148118 2815960 ~ 2816177 (+)
G486899 NA non-coding upstream 152792 2811275 ~ 2811503 (+)
G486929 NA non-coding downstream 15979 2980586 ~ 2980904 (+)
G486948 NA non-coding downstream 256979 3221586 ~ 3221789 (+)
G486965 NA non-coding downstream 291487 3256094 ~ 3256816 (+)
G486972 NA non-coding downstream 312306 3276913 ~ 3277114 (+)
G486986 NA non-coding downstream 402414 3367021 ~ 3370826 (+)
CI01000340_00312480_00313262 NA other upstream 2651050 312212 ~ 313534 (+)
G485427 NA other upstream 2796661 163286 ~ 167634 (+)
G485373 NA other upstream 2850526 106885 ~ 113769 (+)
G487133 NA other downstream 1009308 3973915 ~ 3982545 (+)
CI01000340_04399692_04401164 NA other downstream 1434812 4399419 ~ 4401496 (+)
CI01000340_04660938_04668996 NA other downstream 1699702 4659584 ~ 4669322 (+)
G489634 NA other downstream 3729614 6694221 ~ 6700788 (+)
G490645 NA other downstream 6074205 9038812 ~ 9043101 (+)

Expression


Co-expression Network