G486948


Basic Information

Item Value
gene id G486948
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 3221586 ~ 3221789 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU558728
GGAAGTTAGGTGTTGCTACCTGAGGCAGATCTGAATGGCAGTTTGCGGTCGGTTGTGGAAGATATTTAGCCCCACCCTCAGTATGTCATATGTCATGAAGAGAACAGGGTTGCGTCCAAAAACTTGTTGCCTCACTGCCCTATCCGGCAATAACTTTGCAGGCAGCGTTTGCGCATGAAGGTACCTCACAAAACTGATTTCGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU558728 True 204 lncRNA 0.49 1 3221586 3221789

Neighbor

gene id symbol gene type direction distance location
CI01000340_03053157_03201683 LPP coding upstream 19903 3053157 ~ 3201683 (+)
CI01000340_02930635_02933799 LSM2 coding upstream 287696 2930635 ~ 2933935 (+)
CI01000340_02911658_02928746 INPP5D coding upstream 292242 2910973 ~ 2929344 (+)
CI01000340_02905987_02907006 GPR17 coding upstream 314512 2905128 ~ 2907074 (+)
CI01000340_02870871_02899752 NA coding upstream 321575 2870871 ~ 2900011 (+)
CI01000340_03242647_03264271 NA coding downstream 20858 3242647 ~ 3264850 (+)
CI01000340_03291151_03315214 NA coding downstream 68858 3290647 ~ 3315757 (+)
CI01000340_03320562_03329314 TP63 coding downstream 98680 3320469 ~ 3329682 (+)
CI01000340_03370316_03378878 NA coding downstream 148486 3370275 ~ 3379000 (+)
CI01000340_03471633_03472401 RPL5A, RPL5B, RPL5 coding downstream 249844 3471633 ~ 3472451 (+)
G486929 NA non-coding upstream 240682 2980586 ~ 2980904 (+)
G486858 NA non-coding upstream 256979 2964295 ~ 2964607 (+)
G486927 NA non-coding upstream 311044 2910261 ~ 2910542 (+)
G486913 NA non-coding upstream 325755 2841712 ~ 2895831 (+)
G486965 NA non-coding downstream 34305 3256094 ~ 3256816 (+)
G486972 NA non-coding downstream 55124 3276913 ~ 3277114 (+)
G486986 NA non-coding downstream 145232 3367021 ~ 3370826 (+)
G486990 NA non-coding downstream 154931 3376720 ~ 3377010 (+)
G486991 NA non-coding downstream 155256 3377045 ~ 3377503 (+)
CI01000340_00312480_00313262 NA other upstream 2908341 312212 ~ 313534 (+)
G485427 NA other upstream 3053952 163286 ~ 167634 (+)
G485373 NA other upstream 3107817 106885 ~ 113769 (+)
G487133 NA other downstream 752126 3973915 ~ 3982545 (+)
CI01000340_04399692_04401164 NA other downstream 1177630 4399419 ~ 4401496 (+)
CI01000340_04660938_04668996 NA other downstream 1442520 4659584 ~ 4669322 (+)
G489634 NA other downstream 3472432 6694221 ~ 6700788 (+)
G490645 NA other downstream 5817023 9038812 ~ 9043101 (+)

Expression


Co-expression Network