G488826


Basic Information

Item Value
gene id G488826
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 4267656 ~ 4267872 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU560823
ATCCTGCACTTAATCACAATTTTAACAATCAACATTAATAATTTGCTGTACCACACCAAATGGGGTTTTTATAGATCAAATTAGTTAGCCAAATCAAATCAATTAGCAGTCTGAATATTCCCATCAACACTTTGTTATCCGTCAAGAAGCTCTGCACGGATCTTCCTCATGCCCTAGTAAATGACTACCCCAAAATATTTGTCGAATAACCTTGTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU560823 True 217 lncRNA 0.35 1 4267656 4267872

Neighbor

gene id symbol gene type direction distance location
CI01000340_04086574_04090310 NA coding downstream 177346 4086230 ~ 4090310 (-)
CI01000340_03750211_03772917 NA coding downstream 493740 3749935 ~ 3773916 (-)
CI01000340_03713291_03747080 PEX5L, PEX5LA coding downstream 520384 3712753 ~ 3747272 (-)
CI01000340_03670820_03675367 NA coding downstream 592289 3670713 ~ 3675367 (-)
CI01000340_03622734_03659141 TMEM131 coding downstream 608500 3621970 ~ 3659156 (-)
CI01000340_04277249_04284722 NA coding upstream 9267 4277139 ~ 4285407 (-)
CI01000340_04362537_04371224 LURAP1 coding upstream 94503 4362375 ~ 4371224 (-)
CI01000340_04381260_04383972 TTC4 coding upstream 113212 4381084 ~ 4383972 (-)
CI01000340_04384950_04386594 PARS2 coding upstream 116938 4384810 ~ 4386594 (-)
CI01000340_04403305_04410695 SGIP1A, SGIP1 coding upstream 135284 4403156 ~ 4410695 (-)
G488573 NA non-coding downstream 109134 4125363 ~ 4158522 (-)
G488797 NA non-coding downstream 194201 4073118 ~ 4073455 (-)
G488795 NA non-coding downstream 233277 4034146 ~ 4034379 (-)
G488794 NA non-coding downstream 233792 4033557 ~ 4033864 (-)
G488586 NA non-coding downstream 234428 4030146 ~ 4033228 (-)
G488829 NA non-coding upstream 2346 4270218 ~ 4270487 (-)
G488888 NA non-coding upstream 420142 4688014 ~ 4693632 (-)
G488948 NA non-coding upstream 449708 4717580 ~ 4717841 (-)
G488950 NA non-coding upstream 453969 4721841 ~ 4722055 (-)
G488951 NA non-coding upstream 454976 4722848 ~ 4723114 (-)
G488782 NA other downstream 261208 4005805 ~ 4006448 (-)
G487884 NA other downstream 2365384 1895801 ~ 1902272 (-)
CI01000340_00787534_00791061 NA other downstream 3476247 786551 ~ 791409 (-)
G485786 NA other downstream 3941940 325334 ~ 325716 (-)
CI01000340_00062787_00080635 NA other downstream 4185561 62780 ~ 82095 (-)
G488862 NA other upstream 239324 4507196 ~ 4518120 (-)
CI01000340_04598932_04627160 NA other upstream 332348 4598714 ~ 4627447 (-)
CI01000340_05321995_05329778 ATG4C other upstream 1052881 5320753 ~ 5330215 (-)
CI01000340_06095704_06194498 MAST2 other upstream 1915418 6095704 ~ 6194501 (-)
G489511 NA other upstream 2052585 6320457 ~ 6327372 (-)

Expression


Co-expression Network