G488948


Basic Information

Item Value
gene id G488948
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 4717580 ~ 4717841 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU560947
GACAAATGTCAGAGATCAAATTTGAACAAGGAATAACAAAGTTATTAAGTTATAATTTAAAATTATAGAGACATTAATAAAGTAAATATTTTATATTAAAATCTAGAGTATCTATCCAACAGTATCTAACAGATGAAGATTGTGAGATCAAAATCAGAAGGAAGGAAGATATTTGCAGAATGAAAGGAGAGGTAAGAGAAGCAGGAGGAGCAGAAGCAGAAAAAGCCAAGAGTAAAATAAGAGCAACGAATATACATACAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU560947 True 262 lncRNA 0.30 1 4717580 4717841

Neighbor

gene id symbol gene type direction distance location
CI01000340_04685622_04711254 NA coding downstream 6326 4685450 ~ 4711254 (-)
CI01000340_04598932_04627160 NA coding downstream 90133 4598714 ~ 4627447 (-)
CI01000340_04586637_04588967 NA coding downstream 128217 4586379 ~ 4596261 (-)
CI01000340_04491232_04534682 PDE4B, PDE4BA coding downstream 182898 4490608 ~ 4534682 (-)
CI01000340_04403305_04410695 SGIP1A, SGIP1 coding downstream 306885 4403156 ~ 4410695 (-)
CI01000340_04748822_04770480 DNAJC6 coding upstream 30440 4748281 ~ 4770480 (-)
CI01000340_04787190_04796424 AK4 coding upstream 69097 4786938 ~ 4796424 (-)
CI01000340_04840574_04911814 RAVER2 coding upstream 121462 4839303 ~ 4914305 (-)
CI01000340_04918923_04993041 CACHD1 coding upstream 200773 4918614 ~ 4993274 (-)
CI01000340_05011408_05036816 ROR1 coding upstream 293442 5011283 ~ 5036816 (-)
G488888 NA non-coding downstream 23948 4688014 ~ 4693632 (-)
G488829 NA non-coding downstream 447093 4270218 ~ 4270487 (-)
G488826 NA non-coding downstream 449708 4267656 ~ 4267872 (-)
G488573 NA non-coding downstream 559058 4125363 ~ 4158522 (-)
G488797 NA non-coding downstream 644125 4073118 ~ 4073455 (-)
G488950 NA non-coding upstream 4000 4721841 ~ 4722055 (-)
G488951 NA non-coding upstream 5007 4722848 ~ 4723114 (-)
G488954 NA non-coding upstream 9845 4727686 ~ 4728165 (-)
G488876 NA non-coding upstream 80482 4798323 ~ 4798590 (-)
G488849 NA non-coding upstream 80956 4798797 ~ 4800530 (-)
G488862 NA other downstream 121319 4507196 ~ 4518120 (-)
G488782 NA other downstream 711132 4005805 ~ 4006448 (-)
G487884 NA other downstream 2815308 1895801 ~ 1902272 (-)
CI01000340_00787534_00791061 NA other downstream 3926171 786551 ~ 791409 (-)
CI01000340_05321995_05329778 ATG4C other upstream 602912 5320753 ~ 5330215 (-)
CI01000340_06095704_06194498 MAST2 other upstream 1465449 6095704 ~ 6194501 (-)
G489511 NA other upstream 1602616 6320457 ~ 6327372 (-)
G491712 NA other upstream 4081360 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 5304051 10025656 ~ 10029589 (-)

Expression


Co-expression Network