G487447


Basic Information

Item Value
gene id G487447
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 4727704 ~ 4728019 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU559278
CGCGATTTTTAACCAAGGATACGGGACGTGTCCGGGAGTCGCCTGTCAATGGCGTCATATCCGCGTTACCCTCGGTTTCCGGTTTTGTTTTGTAGAAACCATGGAAACACCAAAGATGCATTAATATATTACATGTTTTATTGACTAGGGAATGACTGTTTGGTTACATTTATAGACAGAAAACGAATTATTGTTATATAGCTCAACACGTTTAGTCTTATTGTTTAAATCTAGTTTTCTTGATTTTCAGAGAGTACCATGCTTTTACCATGCCTCAGAGAAAAACACTATTTTGTCAAGTAGCTAAGTAATACAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU559278 True 316 lncRNA 0.37 1 4727704 4728019

Neighbor

gene id symbol gene type direction distance location
CI01000340_04660938_04668996 NA coding upstream 58382 4659584 ~ 4669322 (+)
CI01000340_04564752_04566790 NA coding upstream 160548 4564611 ~ 4567156 (+)
CI01000340_04399692_04401164 NA coding upstream 326244 4399419 ~ 4401496 (+)
CI01000340_04387653_04393950 NA coding upstream 333585 4387653 ~ 4394119 (+)
CI01000340_04374493_04379773 TTC22 coding upstream 347219 4374316 ~ 4380485 (+)
CI01000340_04809014_04832590 JAK1 coding downstream 80995 4809014 ~ 4832590 (+)
CI01000340_05105114_05112407 NA coding downstream 376340 5104359 ~ 5112713 (+)
CI01000340_05165855_05175759 NA coding downstream 437227 5165246 ~ 5176372 (+)
CI01000340_05338225_05385755 DOCK7 coding downstream 610206 5338225 ~ 5385755 (+)
CI01000340_05433329_05446428 KANK4 coding downstream 705310 5433329 ~ 5446781 (+)
G487446 NA non-coding upstream 368 4727105 ~ 4727336 (+)
G487445 NA non-coding upstream 5032 4722467 ~ 4722672 (+)
G487444 NA non-coding upstream 8188 4719262 ~ 4719516 (+)
G487347 NA non-coding upstream 100674 4547919 ~ 4627030 (+)
G487470 NA non-coding downstream 52332 4780351 ~ 4789726 (+)
G487397 NA non-coding downstream 68792 4796811 ~ 4798223 (+)
G487498 NA non-coding downstream 171868 4899887 ~ 4900735 (+)
G487505 NA non-coding downstream 181205 4909224 ~ 4909874 (+)
G487507 NA non-coding downstream 184260 4912279 ~ 4912502 (+)
G487133 NA other upstream 745159 3973915 ~ 3982545 (+)
CI01000340_02930635_02933799 LSM2 other upstream 1795904 2930635 ~ 2933935 (+)
CI01000340_00312480_00313262 NA other upstream 4414459 312212 ~ 313534 (+)
G489634 NA other downstream 1966202 6694221 ~ 6700788 (+)
G490645 NA other downstream 4310793 9038812 ~ 9043101 (+)
G490826 NA other downstream 4397165 9125184 ~ 9131397 (+)
G490839 NA other downstream 4506954 9234973 ~ 9237559 (+)
G490896 NA other downstream 5103454 9831473 ~ 9845052 (+)

Expression


Co-expression Network