G488965



Basic Information


Item Value
gene id G488965
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 4994888 ~ 5003749 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU560965
GGTCTTCTGACTTCCTCAAGTGGCCAATCTTCTTTATTAAGACCTCAGGGTTCCTTTCATGTCTTCAGATCTTCTCATAGAGTAGAGTGGACACCAATGGGCCACTGAACCCCATGTGAAGAGGACCTGTTTCAAGAAAAGGTCATGTAAAGGAATGTGGCCCCTTGTGGGGTCAGAGTTTAAAAGTCAGGGGTCGCCTTCGTTCTCTTAATGGAGCAGTCCATTGGCATCGGCAACAGCAGGAGGAGAAACTGCGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU560965 True 257 lncRNA 0.49 3 4994888 5003749

Neighbor


gene id symbol gene type direction distance location
CI01000340_04918923_04993041 CACHD1 coding downstream 1614 4918614 ~ 4993274 (-)
CI01000340_04840574_04911814 RAVER2 coding downstream 80583 4839303 ~ 4914305 (-)
CI01000340_04787190_04796424 AK4 coding downstream 198464 4786938 ~ 4796424 (-)
CI01000340_04748822_04770480 DNAJC6 coding downstream 224408 4748281 ~ 4770480 (-)
CI01000340_04685622_04711254 NA coding downstream 283634 4685450 ~ 4711254 (-)
CI01000340_05011408_05036816 ROR1 coding upstream 7534 5011283 ~ 5036816 (-)
CI01000340_05142661_05150544 PGM1, PGM2 coding upstream 138709 5142458 ~ 5150627 (-)
CI01000340_05153622_05164991 EFCAB7 coding upstream 149810 5153559 ~ 5165049 (-)
CI01000340_05177681_05192437 ALG6 coding upstream 173844 5177593 ~ 5192437 (-)
CI01000340_05196551_05197666 FOXD3 coding upstream 192379 5196128 ~ 5198285 (-)
G488849 NA non-coding downstream 194358 4798797 ~ 4800530 (-)
G488876 NA non-coding downstream 196298 4798323 ~ 4798590 (-)
G488954 NA non-coding downstream 266723 4727686 ~ 4728165 (-)
G488951 NA non-coding downstream 271774 4722848 ~ 4723114 (-)
G488950 NA non-coding downstream 272833 4721841 ~ 4722055 (-)
G488971 NA non-coding upstream 4904 5008653 ~ 5008993 (-)
G488853 NA non-coding upstream 86486 5090235 ~ 5132749 (-)
G488878 NA non-coding upstream 147566 5151315 ~ 5152688 (-)
G489030 NA non-coding upstream 268311 5272060 ~ 5272285 (-)
G489032 NA non-coding upstream 279164 5282913 ~ 5283225 (-)
CI01000340_04598932_04627160 NA other downstream 335827 4598714 ~ 4627447 (-)
G488862 NA other downstream 398627 4507196 ~ 4518120 (-)
G488782 NA other downstream 988440 4005805 ~ 4006448 (-)
G487884 NA other downstream 3092616 1895801 ~ 1902272 (-)
CI01000340_00787534_00791061 NA other downstream 4203479 786551 ~ 791409 (-)
CI01000340_05321995_05329778 ATG4C other upstream 317004 5320753 ~ 5330215 (-)
CI01000340_06095704_06194498 MAST2 other upstream 1179541 6095704 ~ 6194501 (-)
G489511 NA other upstream 1316708 6320457 ~ 6327372 (-)
G491712 NA other upstream 3795452 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 5018143 10025656 ~ 10029589 (-)

Expression



Co-expression Network