G487658


Basic Information

Item Value
gene id G487658
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 5224326 ~ 5224700 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU559524
CGAATCAGTGGTTCAGAGCTCCAAAATCACATTTCGGCACTTACGATTTCAGTAAACGAGGCTTCGTTACGTCATAAGTGTTTCGAAATTTCAATAGTTCAGGTGACTTTGGCAGTTTGATACACGCTCCGAACCACTGATTCGAAACAAAAGATTCGTAAAGCTTCGAAGCTTCATGAAGAAGTTTTTGAAATCGCTCATCACTAGATTGTTGAGGCATTATTTTGTTTTTTGTTTTTTTGGCGCAAAAAAAGTATTCTCATCGCTTTAAAATATTAAGGTTGAACCACTGTACTCACATGAACTGTTTTAAATATGTTTTTAGTACTTTTCTGGGCATTGAGAAAGGAAATGATCTTGCTGGCAATGCAGGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU559524 True 375 lncRNA 0.37 1 5224326 5224700

Neighbor

gene id symbol gene type direction distance location
CI01000340_05165855_05175759 NA coding upstream 47954 5165246 ~ 5176372 (+)
CI01000340_05105114_05112407 NA coding upstream 111613 5104359 ~ 5112713 (+)
CI01000340_04809014_04832590 JAK1 coding upstream 391736 4809014 ~ 4832590 (+)
CI01000340_04660938_04668996 NA coding upstream 555004 4659584 ~ 4669322 (+)
CI01000340_04564752_04566790 NA coding upstream 657170 4564611 ~ 4567156 (+)
CI01000340_05338225_05385755 DOCK7 coding downstream 113525 5338225 ~ 5385755 (+)
CI01000340_05433329_05446428 KANK4 coding downstream 208629 5433329 ~ 5446781 (+)
CI01000340_05646434_05651598 NA coding downstream 420937 5645637 ~ 5652345 (+)
CI01000340_05697468_05705929 GHRHRB coding downstream 472617 5697317 ~ 5706900 (+)
CI01000340_05781697_05792066 POMGNT1, MGC81332, POMGNT1.S coding downstream 556152 5780852 ~ 5792678 (+)
G487638 NA non-coding upstream 71362 5152490 ~ 5152964 (+)
G487602 NA non-coding upstream 73710 5142443 ~ 5150616 (+)
G487581 NA non-coding upstream 134653 5089469 ~ 5089673 (+)
G487580 NA non-coding upstream 141047 5083013 ~ 5083279 (+)
G487507 NA non-coding upstream 311824 4912279 ~ 4912502 (+)
G487709 NA non-coding downstream 319096 5543796 ~ 5573983 (+)
G487724 NA non-coding downstream 363746 5588446 ~ 5606729 (+)
G487775 NA non-coding downstream 431314 5656014 ~ 5670162 (+)
G487799 NA non-coding downstream 514817 5739517 ~ 5748252 (+)
G487808 NA non-coding downstream 531684 5756384 ~ 5756606 (+)
CI01000340_04399692_04401164 NA other upstream 822830 4399419 ~ 4401496 (+)
G487133 NA other upstream 1241781 3973915 ~ 3982545 (+)
CI01000340_02930635_02933799 LSM2 other upstream 2292526 2930635 ~ 2933935 (+)
CI01000340_00312480_00313262 NA other upstream 4911081 312212 ~ 313534 (+)
G489634 NA other downstream 1469521 6694221 ~ 6700788 (+)
G490645 NA other downstream 3814112 9038812 ~ 9043101 (+)
G490826 NA other downstream 3900484 9125184 ~ 9131397 (+)
G490839 NA other downstream 4010273 9234973 ~ 9237559 (+)
G490896 NA other downstream 4606773 9831473 ~ 9845052 (+)

Expression


Co-expression Network