G487775


Basic Information

Item Value
gene id G487775
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 5656014 ~ 5670162 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU559655
ACAATGGCCACTGTGTTGGTGTAATTGAGAGTGGTACACAGAAACAGGATCTTGCCTTTGTGCTATGTCAACAGCTTTGGAAAAAAAATCATGTATAGGAGGAAGGATGAGAAGGATTCTAACTAGAGATTACACCAGCTCCAGTTTGGATCCAGCCTCTTACGAAGACTTCAGATGACGAAACACCTGTGAAGAGATGACGCCAACCCCATGTGAGGACTTCAGATGACGCCAACTCCGAATCAACATGCACCACTGCCAAATTTTCTATATATTGTAATTGTAATCATTATGATCACAACTTGTAATAATTGTTTTAATGAGCTCATTTTTTTCTGCATAAATGATTACATGATGTTAGCTAACTACATGATTTGAATTATTTTAGAATTCTACATTTCTGACATATGGACATTACTTGGACACAGTCACCTCTGAATAACAGATTACTCTAAATGGTAGAAACGTGCATTTTTTGTAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU559655 True 481 lncRNA 0.37 2 5656014 5670162

Neighbor

gene id symbol gene type direction distance location
CI01000340_05646434_05651598 NA coding upstream 3669 5645637 ~ 5652345 (+)
CI01000340_05433329_05446428 KANK4 coding upstream 209233 5433329 ~ 5446781 (+)
CI01000340_05338225_05385755 DOCK7 coding upstream 270259 5338225 ~ 5385755 (+)
CI01000340_05165855_05175759 NA coding upstream 479642 5165246 ~ 5176372 (+)
CI01000340_05105114_05112407 NA coding upstream 543301 5104359 ~ 5112713 (+)
CI01000340_05697468_05705929 GHRHRB coding downstream 27155 5697317 ~ 5706900 (+)
CI01000340_05781697_05792066 POMGNT1, MGC81332, POMGNT1.S coding downstream 110690 5780852 ~ 5792678 (+)
CI01000340_05875022_05877021 NA coding downstream 204425 5874587 ~ 5877298 (+)
CI01000340_05942559_05948192 NA coding downstream 271814 5941976 ~ 5949268 (+)
CI01000340_05967007_05972445 NA coding downstream 296554 5966716 ~ 5972589 (+)
G487724 NA non-coding upstream 49285 5588446 ~ 5606729 (+)
G487709 NA non-coding upstream 82031 5543796 ~ 5573983 (+)
G487658 NA non-coding upstream 431314 5224326 ~ 5224700 (+)
G487638 NA non-coding upstream 503050 5152490 ~ 5152964 (+)
G487602 NA non-coding upstream 505398 5142443 ~ 5150616 (+)
G487799 NA non-coding downstream 69355 5739517 ~ 5748252 (+)
G487808 NA non-coding downstream 86222 5756384 ~ 5756606 (+)
G487812 NA non-coding downstream 92418 5762580 ~ 5762813 (+)
G487814 NA non-coding downstream 94661 5764823 ~ 5770886 (+)
G489237 NA non-coding downstream 159152 5829314 ~ 5829540 (+)
CI01000340_04660938_04668996 NA other upstream 990829 4659584 ~ 4669322 (+)
CI01000340_04399692_04401164 NA other upstream 1254518 4399419 ~ 4401496 (+)
G487133 NA other upstream 1673469 3973915 ~ 3982545 (+)
CI01000340_02930635_02933799 LSM2 other upstream 2724214 2930635 ~ 2933935 (+)
CI01000340_00312480_00313262 NA other upstream 5342769 312212 ~ 313534 (+)
G489634 NA other downstream 1024059 6694221 ~ 6700788 (+)
G490645 NA other downstream 3368650 9038812 ~ 9043101 (+)
G490826 NA other downstream 3455022 9125184 ~ 9131397 (+)
G490839 NA other downstream 3564811 9234973 ~ 9237559 (+)
G490896 NA other downstream 4161311 9831473 ~ 9845052 (+)

Expression


Co-expression Network