G489161


Basic Information

Item Value
gene id G489161
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 5670531 ~ 5670749 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU561176
CCCAGGTCTGTTCATTGCCCTCATTTAGCCTTTTTAAATTTCATTGTGAAACTGTGATTGTCTTGTTTGACTGATCATTATGCATATTTAATGAACTGATGGGACTATCGAAACTGAACTCAGTCACAATTGAGCATCTGTGTTTCTTTGGCTGTCCCTGAGGGAAATAACAATTTGCATATGTATTTGATGTTTTTATCCAGCTAGGGAAAACATTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU561176 True 219 lncRNA 0.37 1 5670531 5670749

Neighbor

gene id symbol gene type direction distance location
CI01000340_05576979_05643605 NA coding downstream 26926 5576979 ~ 5643605 (-)
CI01000340_05562762_05566332 NA coding downstream 104199 5562616 ~ 5566332 (-)
CI01000340_05450963_05454017 NA coding downstream 215012 5450393 ~ 5455519 (-)
CI01000340_05387790_05394295 USP1 coding downstream 276086 5386989 ~ 5394445 (-)
CI01000340_05321995_05329778 ATG4C coding downstream 340316 5320753 ~ 5330215 (-)
CI01000340_05717260_05723962 ADCYAP1R1B coding upstream 45454 5716203 ~ 5723962 (-)
CI01000340_05739446_05740109 NA coding upstream 68232 5738981 ~ 5742133 (-)
CI01000340_05778950_05780358 NA coding upstream 108112 5778861 ~ 5780429 (-)
CI01000340_05796381_05802803 NA coding upstream 125632 5796381 ~ 5802803 (-)
CI01000340_06068195_06072250 NA coding upstream 396308 6067057 ~ 6072288 (-)
G489159 NA non-coding downstream 3697 5666518 ~ 5666834 (-)
G489108 NA non-coding downstream 151413 5518182 ~ 5519118 (-)
G489083 NA non-coding downstream 221426 5448877 ~ 5449105 (-)
G489032 NA non-coding downstream 387306 5282913 ~ 5283225 (-)
G489030 NA non-coding downstream 398246 5272060 ~ 5272285 (-)
G489162 NA non-coding upstream 2776 5673525 ~ 5673873 (-)
G489189 NA non-coding upstream 85616 5756365 ~ 5756630 (-)
G489195 NA non-coding upstream 110403 5781152 ~ 5781883 (-)
G489199 NA non-coding upstream 123036 5793785 ~ 5793997 (-)
G489458 NA non-coding upstream 183565 5854314 ~ 5854546 (-)
CI01000340_04598932_04627160 NA other downstream 1011470 4598714 ~ 4627447 (-)
G488862 NA other downstream 1074270 4507196 ~ 4518120 (-)
G488782 NA other downstream 1664083 4005805 ~ 4006448 (-)
G487884 NA other downstream 3768259 1895801 ~ 1902272 (-)
CI01000340_06095704_06194498 MAST2 other upstream 512541 6095704 ~ 6194501 (-)
G489511 NA other upstream 649708 6320457 ~ 6327372 (-)
G491712 NA other upstream 3128452 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 4351143 10025656 ~ 10029589 (-)
CI01000340_10357202_10357606 NA other upstream 4686435 10356758 ~ 10359856 (-)

Expression


Co-expression Network