G489978


Basic Information

Item Value
gene id G489978
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 7028892 ~ 7029208 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU562096
ATTTTTGAAACTGATTGACCGTAGGCCTCACTGATCTGAGCCTCACTGATTTGAGGATAAAGTTCATGTCTGTGCAAAAGAGAGCCTGTAACACTCAATAGTTTGTTTATGAACGTGTGTGTATGTGCACGGATGCAGGAGTATGCATGTATACACACATGCACAGGTCAGAGGCCTTTTTTTTGCAAGGCCACATGTACATATGTGAACAGGAACAAGATGAACACAACTCCTGAACACTAATTGTTTCTCTGAATTTCTACTCCCCCATTCATTTTCAATGGGCGGTCATTTTTGACCAATATAAGCTCAGATCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU562096 True 317 lncRNA 0.41 1 7028892 7029208

Neighbor

gene id symbol gene type direction distance location
CI01000340_06927893_06929574 NA coding upstream 99219 6927788 ~ 6929673 (+)
CI01000340_06769655_06778207 UHMK1 coding upstream 250685 6769655 ~ 6778207 (+)
CI01000340_06702811_06703207 NA coding upstream 325461 6702811 ~ 6703903 (+)
CI01000340_06677894_06691556 IL12RB2 coding upstream 337323 6677894 ~ 6691569 (+)
CI01000340_06656187_06669677 NA coding upstream 357423 6656022 ~ 6671469 (+)
CI01000340_07451476_07454866 RHCG, RHCGL1 coding downstream 422166 7451374 ~ 7455412 (+)
CI01000340_07482030_07483694 NA coding downstream 452822 7482030 ~ 7483902 (+)
CI01000340_07486593_07487826 NA coding downstream 457269 7486477 ~ 7487826 (+)
CI01000340_07641488_07649078 NA coding downstream 611938 7641146 ~ 7649494 (+)
CI01000340_07692812_07697115 TMEM45A coding downstream 663604 7692812 ~ 7697333 (+)
G489956 NA non-coding upstream 14546 7013718 ~ 7014346 (+)
G489950 NA non-coding upstream 26068 7002303 ~ 7002824 (+)
G489766 NA non-coding upstream 33208 6995363 ~ 6995684 (+)
G489763 NA non-coding upstream 40124 6985994 ~ 6988768 (+)
G489759 NA non-coding upstream 49772 6978871 ~ 6979120 (+)
G489985 NA non-coding downstream 5421 7034629 ~ 7034959 (+)
G489984 NA non-coding downstream 6436 7035644 ~ 7035842 (+)
G490008 NA non-coding downstream 55769 7084977 ~ 7085298 (+)
G490013 NA non-coding downstream 62659 7091867 ~ 7092133 (+)
G490045 NA non-coding downstream 124086 7153294 ~ 7153523 (+)
G489634 NA other upstream 328104 6694221 ~ 6700788 (+)
CI01000340_04660938_04668996 NA other upstream 2363707 4659584 ~ 4669322 (+)
CI01000340_04399692_04401164 NA other upstream 2627396 4399419 ~ 4401496 (+)
G487133 NA other upstream 3046347 3973915 ~ 3982545 (+)
CI01000340_02930635_02933799 LSM2 other upstream 4097092 2930635 ~ 2933935 (+)
G490645 NA other downstream 2009604 9038812 ~ 9043101 (+)
G490826 NA other downstream 2095976 9125184 ~ 9131397 (+)
G490839 NA other downstream 2205765 9234973 ~ 9237559 (+)
G490896 NA other downstream 2802265 9831473 ~ 9845052 (+)
G492194 NA other downstream 3622475 10651683 ~ 10652694 (+)

Expression


Co-expression Network