G491180


Basic Information

Item Value
gene id G491180
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 7504749 ~ 7504955 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU563462
TTTTCATCCCGCCTGGCAGGCGAGACCCAGCGCCCTGCTGCTGAAATTAGGCGTCGAATGGCCTCTCTTTCTGCTGGTGTCAGACACGGGGCCCTTATGAGAGATTTGTTGATATGATAACTTGATTAGGCCTCAGGCATGGTGGCAGAGAACGAGAGAGACTCTGCTCTCACTCCTTAACCTCTCCTCAGGAGACTGCAATTAGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU563462 True 207 lncRNA 0.53 1 7504749 7504955

Neighbor

gene id symbol gene type direction distance location
CI01000340_07347497_07355645 NA coding downstream 147899 7346820 ~ 7356850 (-)
CI01000340_07316270_07338395 BRINP3A.2, BRINP3 coding downstream 165406 7315451 ~ 7339343 (-)
CI01000340_07094782_07128154 BRINP3A.1 coding downstream 376507 7094491 ~ 7128242 (-)
CI01000340_06980994_06986987 RGS8 coding downstream 516335 6980923 ~ 6988414 (-)
CI01000340_06967769_06969169 RGS16 coding downstream 535541 6967002 ~ 6969208 (-)
CI01000340_07543307_07544545 HES1, HER6 coding upstream 38064 7543019 ~ 7544752 (-)
CI01000340_07546144_07547567 NA coding upstream 40724 7545679 ~ 7547567 (-)
CI01000340_07651745_07673195 OPA1 coding upstream 146033 7650988 ~ 7673671 (-)
CI01000340_07778322_07787234 NA coding upstream 272788 7777743 ~ 7787463 (-)
CI01000340_07994499_07999442 CTH, CGL coding upstream 489544 7994499 ~ 7999651 (-)
G491179 NA non-coding downstream 16667 7486448 ~ 7488082 (-)
G491168 NA non-coding downstream 48169 7451153 ~ 7456580 (-)
G491154 NA non-coding downstream 65714 7438824 ~ 7439035 (-)
G491147 NA non-coding downstream 89080 7415410 ~ 7415669 (-)
G490215 NA non-coding downstream 201697 7265768 ~ 7303052 (-)
G491183 NA non-coding upstream 4024 7508979 ~ 7509190 (-)
G491203 NA non-coding upstream 24855 7529810 ~ 7530032 (-)
G491205 NA non-coding upstream 31475 7536430 ~ 7536656 (-)
G491210 NA non-coding upstream 43860 7548815 ~ 7549022 (-)
G491232 NA non-coding upstream 61721 7566676 ~ 7566906 (-)
G489511 NA other downstream 1177377 6320457 ~ 6327372 (-)
CI01000340_06095704_06194498 MAST2 other downstream 1284107 6095704 ~ 6194501 (-)
CI01000340_05321995_05329778 ATG4C other downstream 2179605 5320753 ~ 5330215 (-)
CI01000340_04598932_04627160 NA other downstream 2845688 4598714 ~ 4627447 (-)
G488862 NA other downstream 2908488 4507196 ~ 4518120 (-)
G491712 NA other upstream 1294246 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 2516937 10025656 ~ 10029589 (-)
CI01000340_10357202_10357606 NA other upstream 2852229 10356758 ~ 10359856 (-)
G493109 NA other upstream 4168791 11673746 ~ 11677994 (-)
G493266 NA other upstream 4562222 12067177 ~ 12116900 (-)

Expression


Co-expression Network