G491205


Basic Information

Item Value
gene id G491205
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 7536430 ~ 7536656 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU563487
GCAAAAATCAGTATTTAGTGTGACCTCCTGGACTTCCAGTTTCTCAAAGAAGAAAATCTGAGAAACTTCTCAGATTTTGAAAGTTTTCTTGGCCATCCAGTCCTTTTCCATTCCATTTAGGTTTAAGAGAACTGGTTCCTGCTATTGCTCAAGTGTAAGGAAAGGTCTCTAAATACTTGCCACTTTAACCTATAGAAGCCACTTTTTCAGATTTTTTTCTGTTTTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU563487 True 227 lncRNA 0.36 1 7536430 7536656

Neighbor

gene id symbol gene type direction distance location
CI01000340_07347497_07355645 NA coding downstream 179580 7346820 ~ 7356850 (-)
CI01000340_07316270_07338395 BRINP3A.2, BRINP3 coding downstream 197087 7315451 ~ 7339343 (-)
CI01000340_07094782_07128154 BRINP3A.1 coding downstream 408188 7094491 ~ 7128242 (-)
CI01000340_06980994_06986987 RGS8 coding downstream 548016 6980923 ~ 6988414 (-)
CI01000340_06967769_06969169 RGS16 coding downstream 567222 6967002 ~ 6969208 (-)
CI01000340_07543307_07544545 HES1, HER6 coding upstream 6363 7543019 ~ 7544752 (-)
CI01000340_07546144_07547567 NA coding upstream 9023 7545679 ~ 7547567 (-)
CI01000340_07651745_07673195 OPA1 coding upstream 114332 7650988 ~ 7673671 (-)
CI01000340_07778322_07787234 NA coding upstream 241087 7777743 ~ 7787463 (-)
CI01000340_07994499_07999442 CTH, CGL coding upstream 457843 7994499 ~ 7999651 (-)
G491203 NA non-coding downstream 6398 7529810 ~ 7530032 (-)
G491183 NA non-coding downstream 27240 7508979 ~ 7509190 (-)
G491180 NA non-coding downstream 31475 7504749 ~ 7504955 (-)
G491179 NA non-coding downstream 48348 7486448 ~ 7488082 (-)
G491168 NA non-coding downstream 79850 7451153 ~ 7456580 (-)
G491210 NA non-coding upstream 12159 7548815 ~ 7549022 (-)
G491232 NA non-coding upstream 30020 7566676 ~ 7566906 (-)
G491233 NA non-coding upstream 33196 7569852 ~ 7570135 (-)
G491249 NA non-coding upstream 72051 7608707 ~ 7608935 (-)
G491254 NA non-coding upstream 76202 7612858 ~ 7613169 (-)
G489511 NA other downstream 1209058 6320457 ~ 6327372 (-)
CI01000340_06095704_06194498 MAST2 other downstream 1315788 6095704 ~ 6194501 (-)
CI01000340_05321995_05329778 ATG4C other downstream 2211286 5320753 ~ 5330215 (-)
CI01000340_04598932_04627160 NA other downstream 2877369 4598714 ~ 4627447 (-)
G488862 NA other downstream 2940169 4507196 ~ 4518120 (-)
G491712 NA other upstream 1262545 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 2485236 10025656 ~ 10029589 (-)
CI01000340_10357202_10357606 NA other upstream 2820528 10356758 ~ 10359856 (-)
G493109 NA other upstream 4137090 11673746 ~ 11677994 (-)
G493266 NA other upstream 4530521 12067177 ~ 12116900 (-)

Expression


Co-expression Network