G491299


Basic Information

Item Value
gene id G491299
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 7701612 ~ 7702706 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU563587
TGATCATATACCAGTATCCCTTACCGTTCCAACTCTTGTCTCCAGTTCTCCAAAACTGATAAGGGACAAAGCACAAGGAATGGTCCATTTATCTTCAGGCATCCTCGAGCATATGCCAGCAAAGATATGGTCTACAGCAGAGGATCACATCTCACTTATCTGATATCTGACATCTTGGAATAAATCTTTGGCTTAAAAGCAAATAATATAAGCAAGATAAACCCATCACATTACAAACCTGACAAGTCTTGCCCAGACCCATTTCATCTCCAAGGATGCAGCCCTGCTGGTTCTTCATACACTGTGACAGCCACCTCACTCCATCCACCTGATAAGACCTTAGATGAATAGTAGTCCCCATTTTTTCAGGTCACTCTCCGTTATTTCCGATTTGTCCTTTTCTGGTATGTTGTTTCTGACTGCTTGAAGAAATGTTGACATTGTTGTGGTTTAATTACTTAAGCCCTCTAAATTTCGACACTTTATTCAGTCGAATATTAAAGTTATAACAGGTTGCGCGCGCCAGAGGAGTTTGACGTGAACTTCGACATGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU563587 True 553 lncRNA 0.41 2 7701612 7702706

Neighbor

gene id symbol gene type direction distance location
CI01000340_07651745_07673195 OPA1 coding downstream 27941 7650988 ~ 7673671 (-)
CI01000340_07546144_07547567 NA coding downstream 154045 7545679 ~ 7547567 (-)
CI01000340_07543307_07544545 HES1, HER6 coding downstream 156860 7543019 ~ 7544752 (-)
CI01000340_07347497_07355645 NA coding downstream 344762 7346820 ~ 7356850 (-)
CI01000340_07316270_07338395 BRINP3A.2, BRINP3 coding downstream 362269 7315451 ~ 7339343 (-)
CI01000340_07778322_07787234 NA coding upstream 75037 7777743 ~ 7787463 (-)
CI01000340_07994499_07999442 CTH, CGL coding upstream 291793 7994499 ~ 7999651 (-)
CI01000340_08007878_08016645 CTH coding upstream 304991 8007697 ~ 8017282 (-)
CI01000340_08020667_08025048 NIT2 coding upstream 317749 8020455 ~ 8025048 (-)
CI01000340_08029268_08031877 NA coding upstream 326376 8029082 ~ 8032004 (-)
G491254 NA non-coding downstream 88443 7612858 ~ 7613169 (-)
G491249 NA non-coding downstream 92677 7608707 ~ 7608935 (-)
G491233 NA non-coding downstream 131477 7569852 ~ 7570135 (-)
G491232 NA non-coding downstream 134706 7566676 ~ 7566906 (-)
G491210 NA non-coding downstream 152590 7548815 ~ 7549022 (-)
G491216 NA non-coding upstream 29140 7731846 ~ 7733504 (-)
G491325 NA non-coding upstream 80214 7782920 ~ 7808176 (-)
G491355 NA non-coding upstream 137487 7840193 ~ 7841121 (-)
G491362 NA non-coding upstream 151370 7854076 ~ 7855024 (-)
G489511 NA other downstream 1374240 6320457 ~ 6327372 (-)
CI01000340_06095704_06194498 MAST2 other downstream 1480970 6095704 ~ 6194501 (-)
CI01000340_05321995_05329778 ATG4C other downstream 2376468 5320753 ~ 5330215 (-)
CI01000340_04598932_04627160 NA other downstream 3042551 4598714 ~ 4627447 (-)
G488862 NA other downstream 3105351 4507196 ~ 4518120 (-)
G491712 NA other upstream 1096495 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 2319186 10025656 ~ 10029589 (-)
CI01000340_10357202_10357606 NA other upstream 2654478 10356758 ~ 10359856 (-)
G493109 NA other upstream 3971040 11673746 ~ 11677994 (-)
G493266 NA other upstream 4364471 12067177 ~ 12116900 (-)

Expression


Co-expression Network