G491396


Basic Information

Item Value
gene id G491396
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 7896916 ~ 7914183 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU563691
ATTTAAATAATTTAAAAAAAAGAAGAAGAAGGAAAAAAAGACATTTCTAATGTTACAAAAGATTTCTATTTCAATAGTCTTTAAACTTGCTGTTCTGTGAATCAACAGAACAGGCACTGGATCACGGTTTCCACTTTCATTCAGCAGCACAGCTGTTTTCAGCACTGATAATAATAGCTAAGAATGTTTCTTGAGCAGCAAATCAGCATATTAGAATGATTTCTGAAGGATCATGTGACACTGAAGACTGGAGTAACAGGAATAAACAGCCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU563691 True 273 lncRNA 0.33 2 7896916 7914183

Neighbor

gene id symbol gene type direction distance location
CI01000340_07778322_07787234 NA coding downstream 109453 7777743 ~ 7787463 (-)
CI01000340_07651745_07673195 OPA1 coding downstream 223245 7650988 ~ 7673671 (-)
CI01000340_07546144_07547567 NA coding downstream 349349 7545679 ~ 7547567 (-)
CI01000340_07543307_07544545 HES1, HER6 coding downstream 352164 7543019 ~ 7544752 (-)
CI01000340_07347497_07355645 NA coding downstream 540066 7346820 ~ 7356850 (-)
CI01000340_07994499_07999442 CTH, CGL coding upstream 80316 7994499 ~ 7999651 (-)
CI01000340_08007878_08016645 CTH coding upstream 93514 8007697 ~ 8017282 (-)
CI01000340_08020667_08025048 NIT2 coding upstream 106272 8020455 ~ 8025048 (-)
CI01000340_08029268_08031877 NA coding upstream 114899 8029082 ~ 8032004 (-)
CI01000340_08036162_08043659 PLCXD1 coding upstream 121145 8035328 ~ 8044456 (-)
G491394 NA non-coding downstream 1120 7895593 ~ 7895796 (-)
G491393 NA non-coding downstream 2613 7892809 ~ 7894303 (-)
G491392 NA non-coding downstream 4174 7890253 ~ 7892742 (-)
G491391 NA non-coding downstream 7945 7887924 ~ 7888971 (-)
G491363 NA non-coding downstream 41067 7855222 ~ 7855849 (-)
G491402 NA non-coding upstream 3782 7917965 ~ 7918199 (-)
G491410 NA non-coding upstream 18611 7932794 ~ 7933015 (-)
G491415 NA non-coding upstream 27358 7941541 ~ 7941835 (-)
G491417 NA non-coding upstream 29702 7943885 ~ 7944146 (-)
G491427 NA non-coding upstream 32191 7946374 ~ 7946634 (-)
G489511 NA other downstream 1569544 6320457 ~ 6327372 (-)
CI01000340_06095704_06194498 MAST2 other downstream 1676274 6095704 ~ 6194501 (-)
CI01000340_05321995_05329778 ATG4C other downstream 2571772 5320753 ~ 5330215 (-)
CI01000340_04598932_04627160 NA other downstream 3237855 4598714 ~ 4627447 (-)
G488862 NA other downstream 3300655 4507196 ~ 4518120 (-)
G491712 NA other upstream 885018 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 2107709 10025656 ~ 10029589 (-)
CI01000340_10357202_10357606 NA other upstream 2443001 10356758 ~ 10359856 (-)
G493109 NA other upstream 3759563 11673746 ~ 11677994 (-)
G493266 NA other upstream 4152994 12067177 ~ 12116900 (-)

Expression


Co-expression Network