G491415



Basic Information


Item Value
gene id G491415
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 7941541 ~ 7941835 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU563710
AGGGACTCAAAGACAACTATTAAAAAAGGTTCAAACATTCACTGATGCTCCAGAAGGAAACACGATGCATTAAGAGTCAGGGGTGAAAACTTTTGAACAGGATAAAGATGTCCAAATTTTTCTTATTTTGTTTAAATATCATTTTTTTTCATTTAGTACTGCCCTTCGGAAGCAACAGAAGACACTTAAATGTTTGCCAGATGACAAATTAAGTACAATTTACCTTGATCTTCAAATTCAAAAGGTTTTCACCCCCCTTTGAACCTTTTTTAATAGTTGTGTTTGAGTCCCTCAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU563710 True 295 lncRNA 0.34 1 7941541 7941835
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000340_07778322_07787234 NA coding downstream 154078 7777743 ~ 7787463 (-)
CI01000340_07651745_07673195 OPA1 coding downstream 267870 7650988 ~ 7673671 (-)
CI01000340_07546144_07547567 NA coding downstream 393974 7545679 ~ 7547567 (-)
CI01000340_07543307_07544545 HES1, HER6 coding downstream 396789 7543019 ~ 7544752 (-)
CI01000340_07347497_07355645 NA coding downstream 584691 7346820 ~ 7356850 (-)
CI01000340_07994499_07999442 CTH, CGL coding upstream 52664 7994499 ~ 7999651 (-)
CI01000340_08007878_08016645 CTH coding upstream 65862 8007697 ~ 8017282 (-)
CI01000340_08020667_08025048 NIT2 coding upstream 78620 8020455 ~ 8025048 (-)
CI01000340_08029268_08031877 NA coding upstream 87247 8029082 ~ 8032004 (-)
CI01000340_08036162_08043659 PLCXD1 coding upstream 93493 8035328 ~ 8044456 (-)
G491410 NA non-coding downstream 8526 7932794 ~ 7933015 (-)
G491402 NA non-coding downstream 23342 7917965 ~ 7918199 (-)
G491396 NA non-coding downstream 27358 7896916 ~ 7914183 (-)
G491394 NA non-coding downstream 45745 7895593 ~ 7895796 (-)
G491393 NA non-coding downstream 47238 7892809 ~ 7894303 (-)
G491417 NA non-coding upstream 2050 7943885 ~ 7944146 (-)
G491427 NA non-coding upstream 4539 7946374 ~ 7946634 (-)
G491448 NA non-coding upstream 175726 8117561 ~ 8119786 (-)
G491475 NA non-coding upstream 187067 8128902 ~ 8130505 (-)
G489511 NA other downstream 1614169 6320457 ~ 6327372 (-)
CI01000340_06095704_06194498 MAST2 other downstream 1720899 6095704 ~ 6194501 (-)
CI01000340_05321995_05329778 ATG4C other downstream 2616397 5320753 ~ 5330215 (-)
CI01000340_04598932_04627160 NA other downstream 3282480 4598714 ~ 4627447 (-)
G488862 NA other downstream 3345280 4507196 ~ 4518120 (-)
G491712 NA other upstream 857366 8799201 ~ 8799577 (-)
CI01000340_10025958_10028902 SRSF3 other upstream 2080057 10025656 ~ 10029589 (-)
CI01000340_10357202_10357606 NA other upstream 2415349 10356758 ~ 10359856 (-)
G493109 NA other upstream 3731911 11673746 ~ 11677994 (-)
G493266 NA other upstream 4125342 12067177 ~ 12116900 (-)

Expression


G491415 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G491415 Expression in each Bioproject

Bar chart with 42 bars.
G491415 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1250.
End of interactive chart.

Co-expression Network