G490739


Basic Information

Item Value
gene id G490739
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 8860199 ~ 8860517 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU562923
TTTGGGGGATCCGAGGGCTGGGAATTCCTCTGTTTAGCCCATCGCTGCTTGCTGAAGACACAACCCATTCTACTTCTCTTGCTTTATTCCTCCTTAGATATCCTTTCTTTCTCCTCTTACACTTTCTTAGCCCTTGTTTTCCTTAGTCTTCAGTCCAGGTTGCTCCTTGGTTTCCCGTCTCCTCAAGGACGTCTCCTTGTTCCTCAATGTCTTAGCGTCCAGTTCCAACACAGAATCATATCTCTCACACCTTCTTTTCCACACATTCTCTCCCACTTCCAATGTCTCCCTCTAAGTGTCTCTCGGGGTGTCCTCCCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU562923 True 319 lncRNA 0.48 1 8860199 8860517

Neighbor

gene id symbol gene type direction distance location
CI01000340_08774019_08777325 SLC48A1B, SLC48A1 coding upstream 81897 8773837 ~ 8778302 (+)
CI01000340_08763694_08772208 BIN2B coding upstream 87402 8762472 ~ 8772797 (+)
CI01000340_08746450_08751542 STK35L coding upstream 108601 8745319 ~ 8751598 (+)
CI01000340_08710260_08719614 UBE3A coding upstream 140192 8710260 ~ 8720007 (+)
CI01000340_08632493_08682360 ATP10A coding upstream 177794 8632373 ~ 8682405 (+)
CI01000340_08882602_08883850 PRSS60.1, PRSS60.2 coding downstream 22085 8882602 ~ 8883850 (+)
CI01000340_08895637_08897909 PRSS60.2 coding downstream 34853 8895370 ~ 8898290 (+)
CI01000340_08905333_08906557 GPR84 coding downstream 44816 8905333 ~ 8908001 (+)
CI01000340_08938200_08942073 NA coding downstream 77635 8938152 ~ 8942624 (+)
CI01000340_08970483_08982079 B4GN1, B4GALNT1B, B4GALNT1 coding downstream 109925 8970442 ~ 8983411 (+)
G490742 NA non-coding upstream 957 8859009 ~ 8859242 (+)
G490741 NA non-coding upstream 2159 8857830 ~ 8858040 (+)
G490737 NA non-coding upstream 6380 8853609 ~ 8853819 (+)
G490736 NA non-coding upstream 6640 8853283 ~ 8853559 (+)
G490735 NA non-coding upstream 7450 8852530 ~ 8852749 (+)
G490745 NA non-coding downstream 2267 8862784 ~ 8863085 (+)
G490746 NA non-coding downstream 2588 8863105 ~ 8863369 (+)
G490759 NA non-coding downstream 41054 8901571 ~ 8901783 (+)
G490762 NA non-coding downstream 49422 8909939 ~ 8910270 (+)
G490648 NA non-coding downstream 130633 8991150 ~ 9016552 (+)
G489634 NA other upstream 2159411 6694221 ~ 6700788 (+)
CI01000340_04660938_04668996 NA other upstream 4195014 4659584 ~ 4669322 (+)
CI01000340_04399692_04401164 NA other upstream 4458703 4399419 ~ 4401496 (+)
G487133 NA other upstream 4877654 3973915 ~ 3982545 (+)
CI01000340_02930635_02933799 LSM2 other upstream 5928399 2930635 ~ 2933935 (+)
G490645 NA other downstream 178295 9038812 ~ 9043101 (+)
G490826 NA other downstream 264667 9125184 ~ 9131397 (+)
G490839 NA other downstream 374456 9234973 ~ 9237559 (+)
G490896 NA other downstream 970956 9831473 ~ 9845052 (+)
G492194 NA other downstream 1791166 10651683 ~ 10652694 (+)

Expression


Co-expression Network