G492121


Basic Information

Item Value
gene id G492121
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 10498606 ~ 10499307 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU564494
TATAAACATTGTATCATTTATTCATTTTAAAAGTTTGTTTACCAGATTTAAATTAGATTTTGAATCCCTGATTTCCAATGTGGAATATAAATATTGCTGTGCATTGAAACCTTATATTCCTTCGATTTCTTATCCAGCAAACTTAGCTTGCATTTCAGAGACTGGTAATTTTGGTCAACTGGATGAGGCACCATATCCTTCATTTCTTCTGTGGCTTTCTCAGATTCAGCTTTAAGACTCTGGGCAACCTCGATGTCTGCAAGAACCAAAAGCATCTCCTTCTTGCCCTGAAGAACAGAATCATCAGAGATGATAGGGGGTCTGTTGCGGCCAAAGTTATGAGGAATAATGGTGAAGAATTTGTTGGTGAGTTCTTCTAACTTCTTTTGTTCCCCCTTCTTTATTGCAGCTTCAATCTCCTCCAAAGCCTCAAAGCCTTTGGCTATCTGCTGCTTGCTGAGTTTCCCCAAAGGCATCTTCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU564494 True 482 lncRNA 0.39 2 10498606 10499307

Neighbor

gene id symbol gene type direction distance location
CI01000340_10455853_10465771 OXTRL, OXTR coding upstream 32083 10455299 ~ 10466523 (+)
CI01000340_10388851_10395247 NA coding upstream 103339 10388629 ~ 10395267 (+)
CI01000340_10296583_10355505 SRGAP3 coding upstream 142506 10296583 ~ 10356100 (+)
CI01000340_10252718_10253859 NA coding upstream 244153 10252718 ~ 10254453 (+)
CI01000340_10227896_10249819 TWF2, WDR82P1, WDR82.L, WDR82.S, WDR82, SWD2 coding upstream 247838 10227896 ~ 10250768 (+)
CI01000340_10644426_10645811 GPX1, GPX1B coding downstream 145119 10644426 ~ 10645850 (+)
CI01000340_10731548_10747121 MST1RA coding downstream 231366 10730673 ~ 10747648 (+)
CI01000340_10781781_10785861 CAMKVA, CAMKVB, CAMKV coding downstream 282161 10781468 ~ 10787792 (+)
CI01000340_10790372_10803993 NA coding downstream 291065 10790372 ~ 10804399 (+)
CI01000340_10869243_10869956 NA coding downstream 368930 10868237 ~ 10870398 (+)
G492151 NA non-coding upstream 2811 10495568 ~ 10495795 (+)
G492148 NA non-coding upstream 8617 10489744 ~ 10489989 (+)
G492147 NA non-coding upstream 9231 10488817 ~ 10489375 (+)
G492146 NA non-coding upstream 10250 10487953 ~ 10488356 (+)
G492144 NA non-coding upstream 15309 10482986 ~ 10483297 (+)
G492123 NA non-coding downstream 4883 10504190 ~ 10504527 (+)
G492162 NA non-coding downstream 38492 10537799 ~ 10538005 (+)
G492163 NA non-coding downstream 42143 10541450 ~ 10541681 (+)
G492164 NA non-coding downstream 43941 10543248 ~ 10543535 (+)
G492165 NA non-coding downstream 49067 10548374 ~ 10548594 (+)
G490896 NA other upstream 653554 9831473 ~ 9845052 (+)
G490839 NA other upstream 1261047 9234973 ~ 9237559 (+)
G490826 NA other upstream 1367209 9125184 ~ 9131397 (+)
G490645 NA other upstream 1455505 9038812 ~ 9043101 (+)
G489634 NA other upstream 3797818 6694221 ~ 6700788 (+)
G492194 NA other downstream 152376 10651683 ~ 10652694 (+)
G492847 NA other downstream 1109799 11609106 ~ 11696961 (+)
G493617 NA other downstream 2556085 13055392 ~ 13069652 (+)
G493740 NA other downstream 3015920 13515227 ~ 13517111 (+)

Expression


Co-expression Network