G493309


Basic Information

Item Value
gene id G493309
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 12130634 ~ 12131075 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU565845
CTGACCTGAATCTATGGGATATTTTCAAGAGAAAGATGAGAAACAGTCGATCCAACAATATACAGATGATCTGAAGGCTCAATAGTGCCTCAGTAGTGCCACAGGCTGATCACTTCCATGCCACACTTCACTGATGCAGTAATTTGTGCTAGGAGCAAGTCATTTGCTGTAATATGTCCTGCCGATCAAGTATTGAGTGCACAAAAGAACATACTTTAAAGAACTTGAACTTTTCTGTTTTGCAAATCCATTTTTTGATTGATCTTAGGAAATATTCTAATATTTTGAAATACTGGATTTTGGACTTTCATGAGCTGTACGCTCTAATCATCAAAATTTAAAAAAAAAACTTTTGAAATGTTTTACTTTACATGTAGGGAATCTAGAATATATGAAAGTTTCATTTTTAAAAATAATTTATAATAAAAAAATGAACTTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU565845 True 442 lncRNA 0.32 1 12130634 12131075

Neighbor

gene id symbol gene type direction distance location
CI01000340_11903883_11956886 CNTN3B coding downstream 173748 11903780 ~ 11956886 (-)
CI01000340_11779096_11787055 NA coding downstream 341875 11779091 ~ 11788759 (-)
CI01000340_11695434_11705476 PDZRN3B, PDZRN3 coding downstream 424836 11694675 ~ 11705798 (-)
CI01000340_11679110_11679311 NA coding downstream 451323 11678836 ~ 11679311 (-)
CI01000340_11609366_11648905 SHQ1 coding downstream 481729 11609366 ~ 11648905 (-)
CI01000340_12515377_12519838 NA coding upstream 383671 12514746 ~ 12519980 (-)
CI01000340_12532321_12545278 EPHA2A coding upstream 401164 12532239 ~ 12545388 (-)
CI01000340_12562841_12563343 NA coding upstream 431518 12562593 ~ 12563343 (-)
CI01000340_12571142_12574655 TARDBPL, TARDBP coding upstream 439946 12571021 ~ 12574678 (-)
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B coding upstream 446360 12577435 ~ 12625758 (-)
G493266 NA non-coding downstream 21025 12067177 ~ 12116900 (-)
G493267 NA non-coding downstream 43894 12022932 ~ 12086740 (-)
G493268 NA non-coding downstream 105378 12024496 ~ 12025256 (-)
G493196 NA non-coding downstream 117390 12012855 ~ 12013244 (-)
G493060 NA non-coding downstream 146936 11983063 ~ 11983698 (-)
G493311 NA non-coding upstream 2096 12133171 ~ 12134253 (-)
G493315 NA non-coding upstream 14637 12145712 ~ 12145986 (-)
G493330 NA non-coding upstream 62396 12193471 ~ 12193797 (-)
G493402 NA non-coding upstream 183025 12314100 ~ 12314301 (-)
G493403 NA non-coding upstream 183329 12314404 ~ 12314623 (-)
G493109 NA other downstream 452640 11673746 ~ 11677994 (-)
CI01000340_10357202_10357606 NA other downstream 1768230 10356758 ~ 10359856 (-)
CI01000340_10025958_10028902 SRSF3 other downstream 2102651 10025656 ~ 10029589 (-)
G491712 NA other downstream 3331057 8799201 ~ 8799577 (-)
CI01000340_14318434_14336130 NA other upstream 2082273 14318365 ~ 14336258 (-)
CI01000340_14547725_14551493 NA other upstream 2415924 14546999 ~ 14552983 (-)
G494872 NA other upstream 2426548 14557623 ~ 14559023 (-)
G495475 NA other upstream 3475666 15606741 ~ 15612563 (-)

Expression


Co-expression Network