G493330



Basic Information


Item Value
gene id G493330
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 12193471 ~ 12193797 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU565866
CAAAAGTGTAAAGACATTTATAATGTTACAAAAGATTTCTTTTTCAAATTAATGGTGTTCTTTATTAAGAATCCTAAAAAAAGTGTCGCAGTTTCCACAAAAATATTAAGCAGCACAACTGTTTTCAACATTGATAATGATAATACGAAATGTTTCTTGAGCACTAAAATCCGCATATTTAAATGATTTCTGAAGGATCATGTGACACTGAAGACTGGAGTAATGATGCTGAAAATTTTGCTTTGCCATCACATAATATGCTACATATTAAATGTATGAAAACATAAAACCATTGTTTTAAATTGTAATAATATTTTACAATATTAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU565866 True 327 lncRNA 0.27 1 12193471 12193797
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000340_11903883_11956886 CNTN3B coding downstream 236585 11903780 ~ 11956886 (-)
CI01000340_11779096_11787055 NA coding downstream 404712 11779091 ~ 11788759 (-)
CI01000340_11695434_11705476 PDZRN3B, PDZRN3 coding downstream 487673 11694675 ~ 11705798 (-)
CI01000340_11679110_11679311 NA coding downstream 514160 11678836 ~ 11679311 (-)
CI01000340_11609366_11648905 SHQ1 coding downstream 544566 11609366 ~ 11648905 (-)
CI01000340_12515377_12519838 NA coding upstream 320949 12514746 ~ 12519980 (-)
CI01000340_12532321_12545278 EPHA2A coding upstream 338442 12532239 ~ 12545388 (-)
CI01000340_12562841_12563343 NA coding upstream 368796 12562593 ~ 12563343 (-)
CI01000340_12571142_12574655 TARDBPL, TARDBP coding upstream 377224 12571021 ~ 12574678 (-)
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B coding upstream 383638 12577435 ~ 12625758 (-)
G493315 NA non-coding downstream 47485 12145712 ~ 12145986 (-)
G493311 NA non-coding downstream 59218 12133171 ~ 12134253 (-)
G493309 NA non-coding downstream 62396 12130634 ~ 12131075 (-)
G493266 NA non-coding downstream 83862 12067177 ~ 12116900 (-)
G493267 NA non-coding downstream 106731 12022932 ~ 12086740 (-)
G493402 NA non-coding upstream 120303 12314100 ~ 12314301 (-)
G493403 NA non-coding upstream 120607 12314404 ~ 12314623 (-)
G493893 NA non-coding upstream 160331 12354128 ~ 12375232 (-)
G493894 NA non-coding upstream 161021 12354818 ~ 12355089 (-)
G493901 NA non-coding upstream 183450 12377247 ~ 12377503 (-)
G493109 NA other downstream 515477 11673746 ~ 11677994 (-)
CI01000340_10357202_10357606 NA other downstream 1831067 10356758 ~ 10359856 (-)
CI01000340_10025958_10028902 SRSF3 other downstream 2165488 10025656 ~ 10029589 (-)
G491712 NA other downstream 3393894 8799201 ~ 8799577 (-)
CI01000340_14318434_14336130 NA other upstream 2019551 14318365 ~ 14336258 (-)
CI01000340_14547725_14551493 NA other upstream 2353202 14546999 ~ 14552983 (-)
G494872 NA other upstream 2363826 14557623 ~ 14559023 (-)
G495475 NA other upstream 3412944 15606741 ~ 15612563 (-)

Expression


G493330 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G493330 Expression in each Bioproject

Bar chart with 23 bars.
G493330 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network