G493403


Basic Information

Item Value
gene id G493403
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 12314404 ~ 12314623 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU565947
ATTCACTCACCCCAAGTTCCTTTTAAAAGTAATGCATTACAATATTGTGTTACTCCCTAAAAAGTAACTAATTGCGTTACTTAGTTACTTTTTATGGAAAGTAATGCGTTATGTTACTTTTGTGTTACTTTTTTTCATCTGGGATGGGCTGCTTGTTTTTATAACAACAAAATAGTTCTGGCAAATGTAAAGGCCCTTTCAAACCAAAAGTGAAATGAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU565947 True 220 lncRNA 0.32 1 12314404 12314623

Neighbor

gene id symbol gene type direction distance location
CI01000340_11903883_11956886 CNTN3B coding downstream 357518 11903780 ~ 11956886 (-)
CI01000340_11779096_11787055 NA coding downstream 525645 11779091 ~ 11788759 (-)
CI01000340_11695434_11705476 PDZRN3B, PDZRN3 coding downstream 608606 11694675 ~ 11705798 (-)
CI01000340_11679110_11679311 NA coding downstream 635093 11678836 ~ 11679311 (-)
CI01000340_11609366_11648905 SHQ1 coding downstream 665499 11609366 ~ 11648905 (-)
CI01000340_12515377_12519838 NA coding upstream 200123 12514746 ~ 12519980 (-)
CI01000340_12532321_12545278 EPHA2A coding upstream 217616 12532239 ~ 12545388 (-)
CI01000340_12562841_12563343 NA coding upstream 247970 12562593 ~ 12563343 (-)
CI01000340_12571142_12574655 TARDBPL, TARDBP coding upstream 256398 12571021 ~ 12574678 (-)
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B coding upstream 262812 12577435 ~ 12625758 (-)
G493402 NA non-coding downstream 103 12314100 ~ 12314301 (-)
G493330 NA non-coding downstream 120607 12193471 ~ 12193797 (-)
G493315 NA non-coding downstream 168418 12145712 ~ 12145986 (-)
G493311 NA non-coding downstream 180151 12133171 ~ 12134253 (-)
G493309 NA non-coding downstream 183329 12130634 ~ 12131075 (-)
G493893 NA non-coding upstream 39505 12354128 ~ 12375232 (-)
G493894 NA non-coding upstream 40195 12354818 ~ 12355089 (-)
G493901 NA non-coding upstream 62624 12377247 ~ 12377503 (-)
G493904 NA non-coding upstream 76384 12391007 ~ 12391331 (-)
G493905 NA non-coding upstream 83180 12397803 ~ 12398117 (-)
G493266 NA other downstream 197504 12067177 ~ 12116900 (-)
G493109 NA other downstream 636410 11673746 ~ 11677994 (-)
CI01000340_10357202_10357606 NA other downstream 1952000 10356758 ~ 10359856 (-)
CI01000340_10025958_10028902 SRSF3 other downstream 2286421 10025656 ~ 10029589 (-)
G491712 NA other downstream 3514827 8799201 ~ 8799577 (-)
CI01000340_14318434_14336130 NA other upstream 1898725 14318365 ~ 14336258 (-)
CI01000340_14547725_14551493 NA other upstream 2232376 14546999 ~ 14552983 (-)
G494872 NA other upstream 2243000 14557623 ~ 14559023 (-)
G495475 NA other upstream 3292118 15606741 ~ 15612563 (-)

Expression


Co-expression Network