G493987


Basic Information

Item Value
gene id G493987
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 12713627 ~ 12713979 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU566621
AAGCATAAAAGGAGGAGCGACGACAGTGAAGGACGAGAGAGGACCAGGCCTGGACTTTATTTTGTTTTATTATGTTTGTGTGCCCGGCAGTTGTCCGCGAGGGTCTGCCGGCATTACTTTCGTTTTGTTCTTTGTTTATTTTATTAAAGTTTATTGTTTGAACGTTCGCCGGTTCCCGCCTCCTTCTTCCCCCATCATACGAACTGTGTTACATTGGTGCCGAAACCCGGGAGGAAGGAGGGACATGCTGTCGGAGAGCCCTCGCTGCTGAGGGGGATCGCGGTGCTGCGGAGTTCGGGCAGCGCGGGAGTGAAGACCGCGAGAGGCTGCCCGAGGCGGTGGTACTGGAGCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU566621 True 353 lncRNA 0.55 1 12713627 12713979

Neighbor

gene id symbol gene type direction distance location
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B coding downstream 87869 12577435 ~ 12625758 (-)
CI01000340_12571142_12574655 TARDBPL, TARDBP coding downstream 138949 12571021 ~ 12574678 (-)
CI01000340_12562841_12563343 NA coding downstream 150284 12562593 ~ 12563343 (-)
CI01000340_12532321_12545278 EPHA2A coding downstream 168239 12532239 ~ 12545388 (-)
CI01000340_12515377_12519838 NA coding downstream 193647 12514746 ~ 12519980 (-)
CI01000340_12771982_12782800 CAMK1A coding upstream 57594 12771573 ~ 12782800 (-)
CI01000340_12827332_12832015 RDH20 coding upstream 113303 12827282 ~ 12832626 (-)
CI01000340_12846755_12877559 KCNB1 coding upstream 132261 12846240 ~ 12878197 (-)
CI01000340_12881755_12891388 PTGIS coding upstream 167674 12881653 ~ 12891915 (-)
CI01000340_12969774_12974141 TARBP2 coding upstream 254976 12968955 ~ 12974141 (-)
G493956 NA non-coding downstream 264605 12448791 ~ 12449022 (-)
G493955 NA non-coding downstream 267185 12446243 ~ 12446442 (-)
G493920 NA non-coding downstream 268910 12444516 ~ 12444717 (-)
G493919 NA non-coding downstream 269892 12443483 ~ 12443735 (-)
G493918 NA non-coding downstream 275640 12437758 ~ 12437987 (-)
G493942 NA non-coding upstream 46248 12760227 ~ 12760573 (-)
G493939 NA non-coding upstream 46812 12760791 ~ 12812189 (-)
G494005 NA non-coding upstream 111687 12825666 ~ 12826157 (-)
G494014 NA non-coding upstream 188168 12902147 ~ 12902353 (-)
G494076 NA non-coding upstream 372133 13086112 ~ 13086361 (-)
G493266 NA other downstream 596727 12067177 ~ 12116900 (-)
G493109 NA other downstream 1035633 11673746 ~ 11677994 (-)
CI01000340_10357202_10357606 NA other downstream 2351223 10356758 ~ 10359856 (-)
CI01000340_10025958_10028902 SRSF3 other downstream 2685644 10025656 ~ 10029589 (-)
CI01000340_14318434_14336130 NA other upstream 1499369 14318365 ~ 14336258 (-)
CI01000340_14547725_14551493 NA other upstream 1833020 14546999 ~ 14552983 (-)
G494872 NA other upstream 1843644 14557623 ~ 14559023 (-)
G495475 NA other upstream 2892762 15606741 ~ 15612563 (-)
CI01000340_16175837_16177624 NA other upstream 3457698 16171677 ~ 16178314 (-)

Expression


Co-expression Network