G494872


Basic Information

Item Value
gene id G494872
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 14557623 ~ 14559023 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU567578
GTTTCCATACTATATACCTCTCTTATTAACACGGGTAAGTAGGCAGTGAACAAAAAATAACAGCACAAATGCACAATAGAATGGCATGTGATTTACCTTTCTTCCTCCCCTCATCTTCATCAAGATCGAACTCTTTCTCCTCGCCCCCGTCAGCCTCGATCTCTTTTGTTTCCAATTGTTGGCCTTCATCTCCCTCACCACCATCTTCCTCCAGCATGAAAGGCTTCTTCTTCTTCTTCTTCTTCTTGGTCATAGTGGGATCAAATATCATCTCGTCTCCTGACATGGTTTCGACTTGTTGTGAAAACGCAAGACGCAGAAAAATAAGCGTTATAATAGACTATTCTTCACGATACACCTTTCCTCGATATGCGCGTTGCTTGCATCAGGCCGGGCGGAGCTCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU567578 True 405 TUCP 0.44 2 14557623 14559023

Neighbor

gene id symbol gene type direction distance location
CI01000340_14547725_14551493 NA coding downstream 4640 14546999 ~ 14552983 (-)
CI01000340_14515689_14516087 ATP5E coding downstream 41097 14515341 ~ 14516739 (-)
CI01000340_14506530_14506877 NA coding downstream 50746 14506406 ~ 14506877 (-)
CI01000340_14467309_14496470 GNAS.L, MGC68706, GNAS coding downstream 61060 14466969 ~ 14496563 (-)
CI01000340_14455602_14462035 NELFD, NELFCD coding downstream 93816 14455602 ~ 14463807 (-)
CI01000340_14576054_14589873 RALY coding upstream 16813 14575836 ~ 14590203 (-)
CI01000340_14823900_14824982 NA coding upstream 264748 14823771 ~ 14825387 (-)
CI01000340_14835497_14846831 MTSS1 coding upstream 276213 14835236 ~ 14846831 (-)
CI01000340_14872482_14891188 NA coding upstream 313057 14872080 ~ 14891618 (-)
CI01000340_14894726_14899916 OSGN1 coding upstream 334570 14893593 ~ 14899916 (-)
G494855 NA non-coding downstream 14104 14542418 ~ 14543519 (-)
G494719 NA non-coding downstream 91695 14464258 ~ 14465928 (-)
G494852 NA non-coding downstream 110106 14447184 ~ 14447517 (-)
G494851 NA non-coding downstream 110535 14446750 ~ 14447088 (-)
G494869 NA non-coding upstream 3074 14562097 ~ 14564627 (-)
G494902 NA non-coding upstream 157268 14716291 ~ 14716574 (-)
G494867 NA non-coding upstream 184694 14743717 ~ 14745057 (-)
G494861 NA non-coding upstream 188947 14747970 ~ 14749440 (-)
G494854 NA non-coding upstream 195860 14754883 ~ 14756719 (-)
CI01000340_14318434_14336130 NA other downstream 237346 14318365 ~ 14336258 (-)
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B other downstream 1884098 12577435 ~ 12625758 (-)
G493266 NA other downstream 2440723 12067177 ~ 12116900 (-)
G493109 NA other downstream 2879629 11673746 ~ 11677994 (-)
G495475 NA other upstream 1047718 15606741 ~ 15612563 (-)
CI01000340_16175837_16177624 NA other upstream 1612654 16171677 ~ 16178314 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other upstream 1955876 16514899 ~ 16518531 (-)
G496845 NA other upstream 2484700 17043723 ~ 17045688 (-)
G496853 NA other upstream 2618469 17177492 ~ 17242739 (-)

Expression


Co-expression Network