G494902


Basic Information

Item Value
gene id G494902
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 14716291 ~ 14716574 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU567611
TGTTCCCACAAAGTTGGGAGCATGAAATTGTCCAAAATGTCTTGGTATGCTGAAGCATTAAGAGTTCCTTTCACTGGAACTAAGGGGCTAAGCCCAACCCCTGAAAAACAACCCCACACCATAATCCCCCCTCCACCAAACTTTACACTTGGCACAATGCAGTCAGGCAAGTACCGTTCTCCTGGCAACCACCAAACCCAGACTCGTCCATTGGATTGCCAGACAGAGAAGCGTGATTCGTCACTCCAGAGAACACGTCTCCACTGCTCCAGAGTCCAGTGGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU567611 True 284 lncRNA 0.50 1 14716291 14716574

Neighbor

gene id symbol gene type direction distance location
CI01000340_14576054_14589873 RALY coding downstream 126088 14575836 ~ 14590203 (-)
CI01000340_14547725_14551493 NA coding downstream 163308 14546999 ~ 14552983 (-)
CI01000340_14515689_14516087 ATP5E coding downstream 199765 14515341 ~ 14516739 (-)
CI01000340_14506530_14506877 NA coding downstream 209414 14506406 ~ 14506877 (-)
CI01000340_14467309_14496470 GNAS.L, MGC68706, GNAS coding downstream 219728 14466969 ~ 14496563 (-)
CI01000340_14823900_14824982 NA coding upstream 107197 14823771 ~ 14825387 (-)
CI01000340_14835497_14846831 MTSS1 coding upstream 118662 14835236 ~ 14846831 (-)
CI01000340_14872482_14891188 NA coding upstream 155506 14872080 ~ 14891618 (-)
CI01000340_14894726_14899916 OSGN1 coding upstream 177019 14893593 ~ 14899916 (-)
CI01000340_14910995_14919035 PIGU coding upstream 194025 14910599 ~ 14919357 (-)
G494869 NA non-coding downstream 151664 14562097 ~ 14564627 (-)
G494855 NA non-coding downstream 172772 14542418 ~ 14543519 (-)
G494719 NA non-coding downstream 250363 14464258 ~ 14465928 (-)
G494852 NA non-coding downstream 268774 14447184 ~ 14447517 (-)
G494867 NA non-coding upstream 27143 14743717 ~ 14745057 (-)
G494861 NA non-coding upstream 31396 14747970 ~ 14749440 (-)
G494854 NA non-coding upstream 38309 14754883 ~ 14756719 (-)
G494909 NA non-coding upstream 52430 14769004 ~ 14769214 (-)
G495450 NA non-coding upstream 577699 15294273 ~ 15295000 (-)
G494872 NA other downstream 157268 14557623 ~ 14559023 (-)
CI01000340_14318434_14336130 NA other downstream 396014 14318365 ~ 14336258 (-)
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B other downstream 2042766 12577435 ~ 12625758 (-)
G493266 NA other downstream 2599391 12067177 ~ 12116900 (-)
G495475 NA other upstream 890167 15606741 ~ 15612563 (-)
CI01000340_16175837_16177624 NA other upstream 1455103 16171677 ~ 16178314 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other upstream 1798325 16514899 ~ 16518531 (-)
G496845 NA other upstream 2327149 17043723 ~ 17045688 (-)
G496853 NA other upstream 2460918 17177492 ~ 17242739 (-)

Expression


Co-expression Network