G495530


Basic Information

Item Value
gene id G495530
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 15526530 ~ 15526746 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU568328
TCCCGATTCTTTTTGGAGGCTCTTAGAAGTGTAAAAGGAGCGCATTAGTGAAGGGTTTGACATTTGACACGTTTTTGTCACGCCATTATAATGCAATCAGCACCTCTATGCAGCATGATTATTAGGCCAGGTTCACACAGCAACAGAATAGCCTACGTTGTCAGTCCTGCTGTATTTAACACGGTTACGTTCAAGGGGTTAAAAAAGGGGTTTCGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU568328 True 217 lncRNA 0.43 1 15526530 15526746

Neighbor

gene id symbol gene type direction distance location
CI01000340_15433393_15440042 PSMF1 coding downstream 86343 15433316 ~ 15440187 (-)
CI01000340_15418307_15418626 BLCAP.S, GM3852, BC10, BLCAP coding downstream 107904 15417772 ~ 15418667 (-)
CI01000340_15334006_15357378 CHD6 coding downstream 169152 15333088 ~ 15357378 (-)
CI01000340_15318569_15329407 RBL1 coding downstream 196027 15318532 ~ 15330503 (-)
CI01000340_15312803_15315594 NA coding downstream 210936 15312741 ~ 15315594 (-)
CI01000340_15549307_15555642 RIMS4 coding upstream 21729 15548475 ~ 15557779 (-)
CI01000340_15559928_15562340 NA coding upstream 32856 15559602 ~ 15562340 (-)
CI01000340_15614801_15623230 TOMM34 coding upstream 87981 15614727 ~ 15623456 (-)
CI01000340_15666594_15673044 IF6, EIF6.S, EIF6 coding upstream 139714 15666460 ~ 15673044 (-)
CI01000340_15677629_15704765 MMP24 coding upstream 150844 15677590 ~ 15706680 (-)
G495504 NA non-coding downstream 53697 15472524 ~ 15472833 (-)
G495502 NA non-coding downstream 59201 15467062 ~ 15467329 (-)
G495415 NA non-coding downstream 95001 15431216 ~ 15431529 (-)
G495459 NA non-coding downstream 96421 15425649 ~ 15430109 (-)
G495534 NA non-coding upstream 6983 15533729 ~ 15533957 (-)
G495538 NA non-coding upstream 58773 15585519 ~ 15585808 (-)
G495539 NA non-coding upstream 60407 15587153 ~ 15587443 (-)
G495475 NA non-coding upstream 79995 15606741 ~ 15612563 (-)
G495485 NA non-coding upstream 86753 15613499 ~ 15623995 (-)
G494872 NA other downstream 967507 14557623 ~ 14559023 (-)
CI01000340_14547725_14551493 NA other downstream 971362 14546999 ~ 14552983 (-)
CI01000340_14318434_14336130 NA other downstream 1206253 14318365 ~ 14336258 (-)
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B other downstream 2853005 12577435 ~ 12625758 (-)
G493266 NA other downstream 3409630 12067177 ~ 12116900 (-)
CI01000340_16175837_16177624 NA other upstream 644931 16171677 ~ 16178314 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other upstream 988153 16514899 ~ 16518531 (-)
G496845 NA other upstream 1516977 17043723 ~ 17045688 (-)
G496853 NA other upstream 1650746 17177492 ~ 17242739 (-)

Expression


Co-expression Network