G495597


Basic Information

Item Value
gene id G495597
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 15880305 ~ 15880509 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU568398
AGAATATAGCACCATTACTGGCTTTTGGATGGCAGCCCATATCATCTTTAACTACACTACATTATACACAACATCTAGCAGACATATAAAGAGGTGCTGTTATTCCAGACCATTTGCATTTTTTGACTTTTTGCAATTGTTTCCATTAAACTGGCTTTGAAGAACATGCAGGTTCTTGTAAAAGGGGTTTGCTGATTTAATGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU568398 True 205 lncRNA 0.36 1 15880305 15880509

Neighbor

gene id symbol gene type direction distance location
CI01000340_15863675_15876969 RBPJL coding downstream 3336 15863670 ~ 15876969 (-)
CI01000340_15843587_15847043 OSER1 coding downstream 33210 15843161 ~ 15847095 (-)
CI01000340_15818649_15820582 NA coding downstream 59723 15817880 ~ 15820582 (-)
CI01000340_15802368_15806754 GDF5 coding downstream 72911 15800893 ~ 15807394 (-)
CI01000340_15741859_15763888 NA coding downstream 116417 15741357 ~ 15763888 (-)
CI01000340_16001904_16003536 FAM212AB coding upstream 121325 16001834 ~ 16003536 (-)
CI01000340_16006372_16024582 GNAI2 coding upstream 125831 16006340 ~ 16027056 (-)
CI01000340_16053984_16057786 GNAI1 coding upstream 173401 16053910 ~ 16058901 (-)
CI01000340_16061769_16080354 SLC38A3B, SLC38A3 coding upstream 180998 16061507 ~ 16080354 (-)
CI01000340_16101493_16104784 NA coding upstream 219405 16099914 ~ 16104935 (-)
G495588 NA non-coding downstream 20566 15859395 ~ 15859739 (-)
G495587 NA non-coding downstream 21116 15858959 ~ 15859189 (-)
G495582 NA non-coding downstream 22474 15855642 ~ 15857831 (-)
G495581 NA non-coding downstream 26402 15853688 ~ 15853903 (-)
G495491 NA non-coding downstream 157714 15721150 ~ 15722591 (-)
G495585 NA non-coding upstream 2443 15882952 ~ 15883481 (-)
G495586 NA non-coding upstream 14972 15895481 ~ 15895819 (-)
G495600 NA non-coding upstream 18334 15898843 ~ 15899074 (-)
G495584 NA non-coding upstream 20561 15901070 ~ 15901879 (-)
G495603 NA non-coding upstream 38358 15918867 ~ 15919291 (-)
G495475 NA other downstream 267742 15606741 ~ 15612563 (-)
G494872 NA other downstream 1321282 14557623 ~ 14559023 (-)
CI01000340_14547725_14551493 NA other downstream 1325137 14546999 ~ 14552983 (-)
CI01000340_14318434_14336130 NA other downstream 1560028 14318365 ~ 14336258 (-)
CI01000340_12577571_12625562 PTPRG, PTPRGA, CA16B other downstream 3206780 12577435 ~ 12625758 (-)
CI01000340_16175837_16177624 NA other upstream 291168 16171677 ~ 16178314 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other upstream 634390 16514899 ~ 16518531 (-)
G496845 NA other upstream 1163214 17043723 ~ 17045688 (-)
G496853 NA other upstream 1296983 17177492 ~ 17242739 (-)
CI01000340_18419431_18419838 NA other upstream 2538809 18419058 ~ 18421201 (-)

Expression


Co-expression Network