G496699



Basic Information


Item Value
gene id G496699
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 16706728 ~ 16707060 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU569693
GGAAACACTAATTTGAAATAAATCTTTACAAATCAACGTTTGAGAAAAAAAAAATAAAAAAAAAATAAATAAATGTTAAAAATCAAATATAGTTTTTAAGCCTGAGAGAAAAAGTAAGTTTTCAACTTAGATTTAAAATCAGACTCTGTGGCTACTAGTCTTAAAGACAGAGGAAGACTATTCCACAATTTTGGACCAATAATAGTAAAAGCACGGTCACCCCTCGTCTTAAGCCTAGATCTCGGAACCATCAGCAATCTTTGATTAGATGACCTTAATGATGTAGCAGAGTTATTTAATTTCAAAAGTTCAGAGAGATATTTTGGAGCTGAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU569693 True 333 lncRNA 0.30 1 16706728 16707060
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000340_16689196_16692384 NA coding downstream 13393 16689169 ~ 16693335 (-)
CI01000340_16672630_16676596 NA coding downstream 30106 16672555 ~ 16676622 (-)
CI01000340_16661934_16665857 SYS1 coding downstream 40073 16661533 ~ 16666655 (-)
CI01000340_16656861_16660297 NA coding downstream 46431 16656508 ~ 16660297 (-)
CI01000340_16616356_16625161 C20H6ORF106, C26H6ORF106, C11H6ORF106, CLG3H6ORF106, CLG2H6ORF106, C23H6ORF106, CUNH6ORF106, C4H6ORF106 coding downstream 81567 16615555 ~ 16625161 (-)
CI01000340_16835641_16841074 NA coding upstream 128190 16835250 ~ 16841074 (-)
CI01000340_16851655_16855749 TNNI1A, TNNI1B, TNNI1 coding upstream 144351 16851411 ~ 16855749 (-)
CI01000340_16864476_16870042 CSRP1, CSRP1A, CSRP1B coding upstream 157416 16864476 ~ 16870042 (-)
CI01000340_17053954_17065047 NA coding upstream 345317 17052377 ~ 17065047 (-)
CI01000340_17078619_17088012 UBE2C coding upstream 371559 17078619 ~ 17088012 (-)
G496698 NA non-coding downstream 11327 16695139 ~ 16695401 (-)
G496685 NA non-coding downstream 63587 16642624 ~ 16643141 (-)
G496659 NA non-coding downstream 126236 16580113 ~ 16580492 (-)
G496658 NA non-coding downstream 126872 16578942 ~ 16579856 (-)
G496651 NA non-coding downstream 179573 16525546 ~ 16527155 (-)
G496671 NA non-coding upstream 4456 16711516 ~ 16712367 (-)
G496701 NA non-coding upstream 20243 16727303 ~ 16727528 (-)
G496705 NA non-coding upstream 25525 16732585 ~ 16732813 (-)
G496735 NA non-coding upstream 62054 16769114 ~ 16777730 (-)
G496713 NA non-coding upstream 71466 16778526 ~ 16779484 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other downstream 186754 16514899 ~ 16518531 (-)
CI01000340_16175837_16177624 NA other downstream 526643 16171677 ~ 16178314 (-)
G495475 NA other downstream 1094165 15606741 ~ 15612563 (-)
G494872 NA other downstream 2147705 14557623 ~ 14559023 (-)
CI01000340_14547725_14551493 NA other downstream 2151560 14546999 ~ 14552983 (-)
G496845 NA other upstream 336663 17043723 ~ 17045688 (-)
G496853 NA other upstream 470432 17177492 ~ 17242739 (-)
CI01000340_18419431_18419838 NA other upstream 1712258 18419058 ~ 18421201 (-)
G497442 NA other upstream 2451809 19158869 ~ 19166778 (-)

Expression


G496699 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G496699 Expression in each Bioproject

Bar chart with 27 bars.
G496699 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network