G496784


Basic Information

Item Value
gene id G496784
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 16894019 ~ 16894238 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU569789
TGACAGCACTAGTATATAACAATAATAAATTTGTTTTAAGGGTGTATATTTATCAGCAAACTTAACCTGTGCAACTGTTCAAACCAAATCTCAAGGTCACAATTTTGCTTAAATCTGCAAACCTTTAAAAAAGACCGTCAGAAAATAAATTCAATACATTTAGTGAGGTTATCATTCAAGTGAAAACAAAAATCTGCCAATGGAACAAGACAAAATAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU569789 True 220 lncRNA 0.30 1 16894019 16894238

Neighbor

gene id symbol gene type direction distance location
CI01000340_16864476_16870042 CSRP1, CSRP1A, CSRP1B coding downstream 23977 16864476 ~ 16870042 (-)
CI01000340_16851655_16855749 TNNI1A, TNNI1B, TNNI1 coding downstream 38270 16851411 ~ 16855749 (-)
CI01000340_16835641_16841074 NA coding downstream 52945 16835250 ~ 16841074 (-)
CI01000340_16689196_16692384 NA coding downstream 200684 16689169 ~ 16693335 (-)
CI01000340_16672630_16676596 NA coding downstream 217397 16672555 ~ 16676622 (-)
CI01000340_17053954_17065047 NA coding upstream 158139 17052377 ~ 17065047 (-)
CI01000340_17078619_17088012 UBE2C coding upstream 184381 17078619 ~ 17088012 (-)
CI01000340_17094196_17104831 PCIF1 coding upstream 199478 17093716 ~ 17106787 (-)
CI01000340_17122774_17130168 CTSA coding upstream 228158 17122396 ~ 17130168 (-)
CI01000340_17146962_17186247 NA coding upstream 252207 17146445 ~ 17186492 (-)
G496745 NA non-coding downstream 79943 16813778 ~ 16814076 (-)
G496744 NA non-coding downstream 81069 16812731 ~ 16812950 (-)
G496713 NA non-coding downstream 114535 16778526 ~ 16779484 (-)
G496735 NA non-coding downstream 116289 16769114 ~ 16777730 (-)
G496705 NA non-coding downstream 161206 16732585 ~ 16732813 (-)
G496797 NA non-coding upstream 34153 16928391 ~ 16966305 (-)
G496808 NA non-coding upstream 59528 16953766 ~ 16954687 (-)
G496825 NA non-coding upstream 63730 16957968 ~ 16958541 (-)
G496801 NA non-coding upstream 74118 16968356 ~ 16986534 (-)
G496827 NA non-coding upstream 76579 16970817 ~ 16971168 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other downstream 374045 16514899 ~ 16518531 (-)
CI01000340_16175837_16177624 NA other downstream 713934 16171677 ~ 16178314 (-)
G495475 NA other downstream 1281456 15606741 ~ 15612563 (-)
G494872 NA other downstream 2334996 14557623 ~ 14559023 (-)
CI01000340_14547725_14551493 NA other downstream 2338851 14546999 ~ 14552983 (-)
G496845 NA other upstream 149485 17043723 ~ 17045688 (-)
G496853 NA other upstream 283254 17177492 ~ 17242739 (-)
CI01000340_18419431_18419838 NA other upstream 1525080 18419058 ~ 18421201 (-)
G497442 NA other upstream 2264631 19158869 ~ 19166778 (-)

Expression


Co-expression Network