G496854


Basic Information

Item Value
gene id G496854
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 17198333 ~ 17199818 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU569879
GACTTTATAACTCACAATCCTGACTTTATAACTCGCAATTCTGACTTTATATCACACAATCCTGACTTAATGTCTCGCAATTCTGACTTTATATTTCACAATTTTGTTTATAACTCGCAATTCTGACTAAATATAAACTTTATAACTCGCAATTCTGACTTTATCTTGCAATTCTGACTTTATATCACACAATCCTGAATTAATGTCTCGCAATTCTGACTTTATATCACACAATCCTGAATTAATGTCTCGCAATTCTGACTTTATATTTCACAATTTTGTTTATAACTCGCAATTCTGACTTTATATCGCACAATCCTGACTTTATAACTCGCAATTCTGACTTTATATCGCACAATCCTGACTTTATAACTCGCAATTCTGACTTTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU569879 True 391 lncRNA 0.31 2 17198333 17199818

Neighbor

gene id symbol gene type direction distance location
CI01000340_17146962_17186247 NA coding downstream 11841 17146445 ~ 17186492 (-)
CI01000340_17122774_17130168 CTSA coding downstream 68165 17122396 ~ 17130168 (-)
CI01000340_17094196_17104831 PCIF1 coding downstream 91546 17093716 ~ 17106787 (-)
CI01000340_17078619_17088012 UBE2C coding downstream 110321 17078619 ~ 17088012 (-)
CI01000340_17053954_17065047 NA coding downstream 133286 17052377 ~ 17065047 (-)
CI01000340_17245510_17257329 NA coding upstream 44542 17244360 ~ 17257631 (-)
CI01000340_17318768_17326504 CYP24A1 coding upstream 118282 17318100 ~ 17326544 (-)
CI01000340_17354694_17378496 EYA2 coding upstream 154436 17354254 ~ 17378496 (-)
CI01000340_17451836_17453987 NA coding upstream 251634 17451452 ~ 17455983 (-)
CI01000340_17668871_17688583 NA coding upstream 468637 17668455 ~ 17689161 (-)
G496833 NA non-coding downstream 158687 17033136 ~ 17039646 (-)
G496829 NA non-coding downstream 205014 16993086 ~ 16993319 (-)
G496801 NA non-coding downstream 211799 16968356 ~ 16986534 (-)
G496827 NA non-coding downstream 227165 16970817 ~ 16971168 (-)
G496825 NA non-coding downstream 239792 16957968 ~ 16958541 (-)
G496863 NA non-coding upstream 58866 17258684 ~ 17259144 (-)
G496925 NA non-coding upstream 270376 17470194 ~ 17470651 (-)
G496930 NA non-coding upstream 271739 17471557 ~ 17471761 (-)
G496932 NA non-coding upstream 289819 17489637 ~ 17489846 (-)
G496950 NA non-coding upstream 325064 17524882 ~ 17596164 (-)
G496845 NA other downstream 152645 17043723 ~ 17045688 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other downstream 678359 16514899 ~ 16518531 (-)
CI01000340_16175837_16177624 NA other downstream 1018248 16171677 ~ 16178314 (-)
G495475 NA other downstream 1585770 15606741 ~ 15612563 (-)
G494872 NA other downstream 2639310 14557623 ~ 14559023 (-)
CI01000340_18419431_18419838 NA other upstream 1219500 18419058 ~ 18421201 (-)
G497442 NA other upstream 1959051 19158869 ~ 19166778 (-)

Expression


Co-expression Network