G497037


Basic Information

Item Value
gene id G497037
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 17869865 ~ 17870084 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU570085
CGTCACTCACTAGAGCTTCTCTTGAGATCAGAGGAGTGAGGTTTACTCGCACAGTGACTACTAGCTGGCCTCCTTTACACTCACCCCCCTAAACCTCACTAACATCCGGGTCACGGCACCAATGTAACCCCTCACCCAGGTCCTACTTGCCCCGCTCTGCGTGGGCCTCGAACCTGGGTCTCTGGCGTGGGAGTCGGACGCTCTAACATGAAGGCTAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU570085 True 220 lncRNA 0.56 1 17869865 17870084

Neighbor

gene id symbol gene type direction distance location
CI01000340_17700896_17753828 CDH22 coding downstream 116037 17700825 ~ 17753828 (-)
CI01000340_17668871_17688583 NA coding downstream 180704 17668455 ~ 17689161 (-)
CI01000340_17451836_17453987 NA coding downstream 413882 17451452 ~ 17455983 (-)
CI01000340_17354694_17378496 EYA2 coding downstream 491369 17354254 ~ 17378496 (-)
CI01000340_17318768_17326504 CYP24A1 coding downstream 543321 17318100 ~ 17326544 (-)
CI01000340_17996222_18008569 NA coding upstream 125350 17995434 ~ 18010838 (-)
CI01000340_18013773_18027276 DDX27 coding upstream 143447 18013531 ~ 18027276 (-)
CI01000340_18030360_18041157 ITCHB, ITCHA, ITCH coding upstream 160161 18030245 ~ 18041157 (-)
CI01000340_18091595_18104080 CBFA2T2 coding upstream 220724 18090808 ~ 18104080 (-)
CI01000340_18185156_18206837 NA coding upstream 314826 18184910 ~ 18206837 (-)
G497025 NA non-coding downstream 35348 17810886 ~ 17834517 (-)
G497021 NA non-coding downstream 49442 17778714 ~ 17820423 (-)
G496950 NA non-coding downstream 273701 17524882 ~ 17596164 (-)
G496932 NA non-coding downstream 380019 17489637 ~ 17489846 (-)
G496930 NA non-coding downstream 398104 17471557 ~ 17471761 (-)
G497053 NA non-coding upstream 22819 17892903 ~ 17893315 (-)
G497054 NA non-coding upstream 30291 17900375 ~ 17900599 (-)
G497081 NA non-coding upstream 93608 17963692 ~ 17964078 (-)
G497092 NA non-coding upstream 136571 18006655 ~ 18007015 (-)
G497094 NA non-coding upstream 174098 18044182 ~ 18044454 (-)
G496853 NA other downstream 627126 17177492 ~ 17242739 (-)
G496845 NA other downstream 824177 17043723 ~ 17045688 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other downstream 1349891 16514899 ~ 16518531 (-)
CI01000340_16175837_16177624 NA other downstream 1689780 16171677 ~ 16178314 (-)
G495475 NA other downstream 2257302 15606741 ~ 15612563 (-)
CI01000340_18419431_18419838 NA other upstream 549234 18419058 ~ 18421201 (-)
G497442 NA other upstream 1288785 19158869 ~ 19166778 (-)

Expression


Co-expression Network