G497252


Basic Information

Item Value
gene id G497252
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 18647782 ~ 18712131 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU570328
TCAGAATGATTTCTGAAGGATCATGTGACACTGAAGACTGGAGTAATGATGCTGAAAATTCAGCTTTGATCACAGGAATAAATTACACTTTACTATATATTCACATAGAAAACAGCTGATTTACATTGGAATAATATTTCACAATTTTTACTGTATTTTTGATTAGATCATGTGACACTGAAGACTGGAGTAATGATGCTGAAAATTCAGCTTTGAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU570328 True 217 lncRNA 0.31 2 18647782 18712131

Neighbor

gene id symbol gene type direction distance location
CI01000340_18587476_18607063 NA coding downstream 40649 18587330 ~ 18607133 (-)
CI01000340_18572454_18585230 NA coding downstream 62552 18572454 ~ 18585230 (-)
CI01000340_18540426_18543271 SLC32A1.S, SLC32A1, VIAAT coding downstream 103482 18540261 ~ 18544300 (-)
CI01000340_18485385_18491222 NA coding downstream 156189 18484847 ~ 18491593 (-)
CI01000340_18482872_18484601 NA coding downstream 162727 18481349 ~ 18485055 (-)
CI01000340_18871236_18880189 STAC3 coding upstream 158813 18870944 ~ 18880189 (-)
CI01000340_18900583_18906154 NA coding upstream 187546 18899677 ~ 18906154 (-)
CI01000340_19062314_19072746 NA coding upstream 348954 19061085 ~ 19072746 (-)
CI01000340_19115929_19119348 DDIT3 coding upstream 403474 19115605 ~ 19119348 (-)
CI01000340_19142339_19149140 DCTN2 coding upstream 429755 19141886 ~ 19149140 (-)
G497251 NA non-coding downstream 1315 18645497 ~ 18646467 (-)
G497209 NA non-coding downstream 100385 18546952 ~ 18547397 (-)
G497200 NA non-coding downstream 117154 18528327 ~ 18530628 (-)
G497271 NA non-coding upstream 21532 18733663 ~ 18821869 (-)
G497279 NA non-coding upstream 33391 18745522 ~ 18748741 (-)
G497288 NA non-coding upstream 203215 18915346 ~ 18966510 (-)
G497393 NA non-coding upstream 374297 19086428 ~ 19087628 (-)
G497440 NA non-coding upstream 442702 19154833 ~ 19155257 (-)
CI01000340_18419431_18419838 NA other downstream 193102 18419058 ~ 18421201 (-)
G496853 NA other downstream 1405043 17177492 ~ 17242739 (-)
G496845 NA other downstream 1602094 17043723 ~ 17045688 (-)
CI01000340_16515291_16518346 TUSC2A, TUSC2 other downstream 2127808 16514899 ~ 16518531 (-)
CI01000340_16175837_16177624 NA other downstream 2467697 16171677 ~ 16178314 (-)
G497442 NA other upstream 446738 19158869 ~ 19166778 (-)

Expression


Co-expression Network