G507974


Basic Information

Item Value
gene id G507974
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000350
NCBI id null
chromosome length 2572209
location 2180172 ~ 2180438 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU582525
TCAACAATTTATTCTCTTCCATGTCATTCTCCTACGCTGTTCACGTTGTAAACAGTGCAGCGCTTCCAGGTTCTACGTCATCTACTCACTATTGGCTGACGCTGTTCACGTGAGCAGCACGACACATGCATGTGATGCTGACGCAGGAGCCGGCCAATAATGAGTCGGCATTCTGACATAGAACCTGGAAGCGCTGAACGTAAACAGCGTAAGAGACTGACACAGAAGAGAAGATATTGTTGAATAAAGTCGTTATTTTTGTTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU582525 True 267 lncRNA 0.45 1 2180172 2180438

Neighbor

gene id symbol gene type direction distance location
CI01000350_02100526_02105123 CDCA7A coding upstream 74907 2100526 ~ 2105265 (+)
CI01000350_02051537_02098878 ZAK coding upstream 81154 2051537 ~ 2099018 (+)
CI01000350_01860321_01869386 PDK1 coding upstream 310053 1859899 ~ 1870119 (+)
CI01000350_01748423_01750654 NA coding upstream 429116 1748423 ~ 1751056 (+)
CI01000350_01625265_01628425 DLX2A, DLX2 coding upstream 551548 1625143 ~ 1628624 (+)
CI01000350_02225123_02231703 NA coding downstream 44609 2225047 ~ 2232060 (+)
CI01000350_02326331_02328418 SP9 coding downstream 145893 2326331 ~ 2328925 (+)
CI01000350_02342610_02352568 SCRN3 coding downstream 162172 2342610 ~ 2353306 (+)
CI01000350_02387606_02388868 NA coding downstream 207122 2387560 ~ 2388902 (+)
CI01000350_02502767_02507641 BZW1, BZW1B coding downstream 321588 2502026 ~ 2507641 (+)
G507961 NA non-coding upstream 192 2178156 ~ 2179980 (+)
G508034 NA non-coding upstream 4020 2175933 ~ 2176152 (+)
G508033 NA non-coding upstream 4336 2175576 ~ 2175836 (+)
G508031 NA non-coding upstream 7364 2172566 ~ 2172808 (+)
G507939 NA non-coding upstream 256847 1910343 ~ 1923325 (+)
G507966 NA non-coding downstream 6848 2187286 ~ 2190894 (+)
G508038 NA non-coding downstream 15400 2195838 ~ 2196343 (+)
G508066 NA non-coding downstream 56924 2237362 ~ 2237593 (+)
G507953 NA non-coding downstream 60087 2240525 ~ 2242441 (+)
G508080 NA non-coding downstream 90597 2271035 ~ 2271269 (+)
G507699 NA other upstream 660344 1515709 ~ 1519828 (+)
CI01000350_01454880_01462490 NA other upstream 717935 1454563 ~ 1462490 (+)
G506858 NA other upstream 1201281 978091 ~ 978891 (+)
G506911 NA other upstream 1414061 765310 ~ 766111 (+)
G506786 NA other upstream 1679416 499096 ~ 500756 (+)

Expression


Co-expression Network