G508082


Basic Information

Item Value
gene id G508082
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000350
NCBI id null
chromosome length 2572209
location 2279260 ~ 2279473 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU582634
ATTAAACACAGGCAGAATAAATGTATGTGTTTATAAAACCATTCTTATGATTCTATAAACAACTTATACAGAAATGTGTTTTCACATACATTTTGGAATGGACACAATTTTGTCTGATAAATCGTCCGATATCACTCTGCAGGGTACATGCTACTGTTTAGCAAACAAACCTGAGGCTCTCACTATGATGTGACAATATAAACACTGCTGAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU582634 True 214 lncRNA 0.34 1 2279260 2279473

Neighbor

gene id symbol gene type direction distance location
CI01000350_02225123_02231703 NA coding upstream 47200 2225047 ~ 2232060 (+)
CI01000350_02100526_02105123 CDCA7A coding upstream 173995 2100526 ~ 2105265 (+)
CI01000350_02051537_02098878 ZAK coding upstream 180242 2051537 ~ 2099018 (+)
CI01000350_01860321_01869386 PDK1 coding upstream 409141 1859899 ~ 1870119 (+)
CI01000350_01748423_01750654 NA coding upstream 528204 1748423 ~ 1751056 (+)
CI01000350_02326331_02328418 SP9 coding downstream 46858 2326331 ~ 2328925 (+)
CI01000350_02342610_02352568 SCRN3 coding downstream 63137 2342610 ~ 2353306 (+)
CI01000350_02387606_02388868 NA coding downstream 108087 2387560 ~ 2388902 (+)
CI01000350_02502767_02507641 BZW1, BZW1B coding downstream 222553 2502026 ~ 2507641 (+)
CI01000350_02564422_02569042 NA coding downstream 284949 2564422 ~ 2570021 (+)
G508080 NA non-coding upstream 7991 2271035 ~ 2271269 (+)
G507953 NA non-coding upstream 36819 2240525 ~ 2242441 (+)
G508066 NA non-coding upstream 41667 2237362 ~ 2237593 (+)
G508038 NA non-coding upstream 82917 2195838 ~ 2196343 (+)
G507966 NA non-coding upstream 88366 2187286 ~ 2190894 (+)
G508083 NA non-coding downstream 186 2279659 ~ 2279865 (+)
G508086 NA non-coding downstream 17122 2296595 ~ 2296908 (+)
G508087 NA non-coding downstream 18543 2298016 ~ 2298493 (+)
G508089 NA non-coding downstream 20448 2299921 ~ 2300128 (+)
G508090 NA non-coding downstream 21864 2301337 ~ 2301575 (+)
G507699 NA other upstream 759432 1515709 ~ 1519828 (+)
CI01000350_01454880_01462490 NA other upstream 817023 1454563 ~ 1462490 (+)
G506858 NA other upstream 1300369 978091 ~ 978891 (+)
G506911 NA other upstream 1513149 765310 ~ 766111 (+)
G506786 NA other upstream 1778504 499096 ~ 500756 (+)

Expression


Co-expression Network