G508158


Basic Information

Item Value
gene id G508158
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000350
NCBI id null
chromosome length 2572209
location 2484736 ~ 2485005 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU582710
AATTGTTCTGATTTTGTCATTGAGGAGGTTCTTGATAAGTCGTGTGATCCTCGTCCAGTTTCCTCAGAAACACCGGCGGCCTGGCCAGTTCGCCAATCGCCGCTTCCCTCCGCCTGCCCCTCCAGTGAGCATTCCCCTGAAGGCCAAAGAAAGATCCTCCGCTGGGCCTAAACGGCCGAGAAGGAAAAGAAAGAAGGCCGTTATACAACCCCAGTCTCCTGAGTTTCCTGCCTCCGTGCAGCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU582710 True 244 lncRNA 0.55 2 2484736 2485005

Neighbor

gene id symbol gene type direction distance location
CI01000350_02387606_02388868 NA coding upstream 95834 2387560 ~ 2388902 (+)
CI01000350_02342610_02352568 SCRN3 coding upstream 131430 2342610 ~ 2353306 (+)
CI01000350_02326331_02328418 SP9 coding upstream 155811 2326331 ~ 2328925 (+)
CI01000350_02225123_02231703 NA coding upstream 252676 2225047 ~ 2232060 (+)
CI01000350_02100526_02105123 CDCA7A coding upstream 379471 2100526 ~ 2105265 (+)
CI01000350_02502767_02507641 BZW1, BZW1B coding downstream 17021 2502026 ~ 2507641 (+)
CI01000350_02564422_02569042 NA coding downstream 79417 2564422 ~ 2570021 (+)
G508145 NA non-coding upstream 29169 2455062 ~ 2455567 (+)
G508099 NA non-coding upstream 116450 2367863 ~ 2368286 (+)
G507963 NA non-coding upstream 152673 2331307 ~ 2332063 (+)
G508090 NA non-coding upstream 183161 2301337 ~ 2301575 (+)
G508089 NA non-coding upstream 184608 2299921 ~ 2300128 (+)
G508172 NA non-coding downstream 33407 2518412 ~ 2518828 (+)
G508182 NA non-coding downstream 70174 2555179 ~ 2555413 (+)
G508137 NA non-coding downstream 71315 2556320 ~ 2556577 (+)
G507699 NA other upstream 964908 1515709 ~ 1519828 (+)
CI01000350_01454880_01462490 NA other upstream 1022499 1454563 ~ 1462490 (+)
G506858 NA other upstream 1505845 978091 ~ 978891 (+)
G506911 NA other upstream 1718625 765310 ~ 766111 (+)

Expression


Co-expression Network