XLOC_013987 (FP074902.6)


Basic Information

Item Value
gene id XLOC_013987
gene name FP074902.6
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 18881888 ~ 18883535 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00027915
aaaaaactcaaggattttagatcctgatgatcgttaaacgcgtcataacagtgttgtgaaaagggtgtaattgttaaaaataggtacaaacattagatataaacaaaaacctaaacaaacacttctatgtacataacgtcataaaaatacttgttttatttacctcgcgctgccgtccttgtactgccgtgaacaggaaattctgggaatggaggacggagagttgaatcgattcgtcttcaacaaaccgatcagtgtgacatcaaaacatcgcgagaacaacagacagctccgtgtgcatttgaatccatctcgcgatattgtatcacttcaggtacgcgcctactgattcgttgattcaaacgagttgtgaatcaagaagcctctaaagatccgaatcaaactgcagcagcacgccactaggttttgctcagacttttgggacgtttggaattgctccgtcttgtcaccatgtaacacatagcagcaagacccatgggatttcatcagccactcaccatcagagtcctcagtggaagctgagaagagcagaagaggaagccaagcaagagatgccagaaaaaaagggggaaggaaataatgtgttattttgctgtttgagtataggcaggtgcagtgggtagcacaatcgcctcacagcaagaaggtcgctggttcgagcctcggctgggtcagttggcatttctgtgtggagtttgcatgttctccccatgttagcgtgggtttcctccgggtgctcccacaagtccaaaaatatgtggtgacattgggtaaggtaaaattgtccgtagtgtatgtgtgtgaatgagtatgtatggatgtttcccagtgatgggttgcagctgggtggcaacacggtggcacagtaggtagtgctgtttcctcacatcaagaaggtttctgcatggagttctccctgcgttcgcgtgggtttc

Function

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000114702

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00027915 True 956 lncRNA 0.45 2 18881888 18883535
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_013986 NA coding upstream 47279 18833009 ~ 18834609 (+)
XLOC_013985 cratb coding upstream 55142 18812805 ~ 18826746 (+)
XLOC_013984 ddah2 coding upstream 73600 18797623 ~ 18808288 (+)
XLOC_013983 clic1 coding upstream 115483 18758014 ~ 18766405 (+)
XLOC_013982 spaca4l coding upstream 129983 18739085 ~ 18751905 (+)
XLOC_013988 slc39a7 coding downstream 19998 18903533 ~ 18915937 (+)
XLOC_013989 NA coding downstream 76373 18959908 ~ 18978279 (+)
XLOC_013990 cmtm8a coding downstream 100365 18983900 ~ 18988067 (+)
XLOC_013991 cpne4b coding downstream 145098 19028633 ~ 19173234 (+)
XLOC_013992 mrpl3 coding downstream 310316 19193851 ~ 19217263 (+)
XLOC_013979 BX649471.1 non-coding upstream 500204 18368869 ~ 18381684 (+)
XLOC_013978 NA non-coding upstream 583977 18293368 ~ 18297911 (+)
XLOC_013977 NA non-coding upstream 708369 18162842 ~ 18173519 (+)
XLOC_013976 NA non-coding upstream 1034955 17846668 ~ 17846933 (+)
XLOC_013994 CR626877.1 non-coding downstream 381224 19264759 ~ 19264881 (+)
XLOC_014003 mir196a-2 non-coding downstream 864084 19747619 ~ 19747694 (+)
XLOC_014004 CR382300.1 non-coding downstream 898878 19782413 ~ 19783624 (+)
XLOC_014014 NA non-coding downstream 1425355 20308890 ~ 20309259 (+)

Expression

Expression of XLOC_013987(FP074902.6) in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Expression of XLOC_013987(FP074902.6) in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network