G520146



Basic Information


Item Value
gene id G520146
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000364
NCBI id null
chromosome length 520240
location 180328 ~ 197248 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU596727
CCTCAGTTTCTTCAATCATGTTTTCACTCTCCTCTTTAATAAACACCATCTTTGTTTGTTCCTCAGTTTCTTCATGTTTCACTCTGGATGTTTCTTCAATCCTCATGTCTTCACCCTCCTCTTTAATAAACGCCATCTTTGTTTGTTCCTCAGTATCTTGTTTCACTCTAAATGTTTCTTCAATCTTCATGTCTTCACTCTCCACTTTAATAAACGCCATCTTTATAATAGTGAGTCACGTGGATCTCAGTCGCTTCACCAGGAGTTTTTCTGTGTGTTTAAGAGGAAAATAATCTTTCTTCAGCCGAATCACAGCAGACGCAGGAGCGCGACGCAACCTTATGACTTCACA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU596727 True 352 lncRNA 0.39 2 180328 197248

Neighbor


gene id symbol gene type direction distance location
CI01000364_00110528_00118790 NA coding downstream 61538 110429 ~ 118790 (-)
CI01000364_00081223_00107594 NA coding downstream 72535 81180 ~ 107793 (-)
CI01000364_00037534_00041491 NA coding downstream 136609 36674 ~ 43719 (-)
CI01000364_00002233_00008090 NA coding downstream 172120 2233 ~ 8208 (-)
CI01000364_00373309_00374559 NA coding upstream 176061 373309 ~ 374559 (-)
CI01000364_00391142_00398789 NA coding upstream 193703 390951 ~ 398930 (-)
CI01000364_00455879_00458332 NA coding upstream 258631 455879 ~ 458332 (-)
G520143 NA non-coding downstream 29659 148351 ~ 150669 (-)
G520128 NA non-coding downstream 108955 70819 ~ 71373 (-)
G520103 NA non-coding downstream 135193 14969 ~ 45135 (-)
G520159 NA non-coding upstream 27060 224308 ~ 225359 (-)
G520107 NA non-coding upstream 34806 232054 ~ 309930 (-)
G520108 NA non-coding upstream 52876 250124 ~ 270995 (-)
G520099 NA non-coding upstream 65760 263008 ~ 264764 (-)
G520221 NA non-coding upstream 227475 424723 ~ 425045 (-)
G520248 NA other upstream 253785 451033 ~ 451562 (-)

Expression



Co-expression Network