G520238



Basic Information


Item Value
gene id G520238
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000364
NCBI id null
chromosome length 520240
location 441403 ~ 441651 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU596830
TGATCTAATTCCTAAATGGCAACGATTCGCTCGTGTATATTAAACCTTTGACAAAAATAAAATCGCGACATTCAAATCTGCGTTTGCGCTGCCGTTGATCTGAAGAGAGTTGTCATGTGTAGATATAAACAGCTTCACAAACAATATTTTCAAACGCACATTATTTCTGTGTGACAAATAGGCCTATTCCAATTATAACAAAAGTATACAAAAGTTTATTATTTAGATAGAAACGCTGGTGTTTATGTA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU596830 True 249 lncRNA 0.33 1 441403 441651

Neighbor


gene id symbol gene type direction distance location
CI01000364_00391142_00398789 NA coding downstream 42473 390951 ~ 398930 (-)
CI01000364_00373309_00374559 NA coding downstream 66844 373309 ~ 374559 (-)
CI01000364_00110528_00118790 NA coding downstream 322613 110429 ~ 118790 (-)
CI01000364_00081223_00107594 NA coding downstream 333610 81180 ~ 107793 (-)
CI01000364_00037534_00041491 NA coding downstream 397684 36674 ~ 43719 (-)
CI01000364_00455879_00458332 NA coding upstream 14228 455879 ~ 458332 (-)
G520221 NA non-coding downstream 16358 424723 ~ 425045 (-)
G520100 NA non-coding downstream 122831 20310 ~ 318572 (-)
G520107 NA non-coding downstream 131473 232054 ~ 309930 (-)
G520108 NA non-coding downstream 170817 250124 ~ 270995 (-)
G520099 NA non-coding downstream 176639 263008 ~ 264764 (-)
G520248 NA non-coding upstream 9546 451033 ~ 451562 (-)
G520259 NA non-coding upstream 21335 462986 ~ 463228 (-)
G520263 NA non-coding upstream 27069 468720 ~ 468944 (-)
G520283 NA non-coding upstream 53109 494760 ~ 495117 (-)

Expression



Co-expression Network