G520252



Basic Information


Item Value
gene id G520252
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000364
NCBI id null
chromosome length 520240
location 456784 ~ 457061 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU596850
CAGACTTCACCCATGATGACCCAACATAAGTCGAGTCGTTGTGGGGCCCATTTATTTGCTCACGTACCTTATGTACTCTCAGTATATCTCATCCTAACAACAGCAGGATAGGAGCATTGGGATCCACAGCTGGAATTTTATCTGCCACTGGCTGCAGGTGAGGATGGTGCCACGCTACCTCAGGAGAGGGAATCTCCGACCTATCATCAGGTATCAAGACACATTCTATTAGAGTAGGGAGCTGAAGTTGAAGCTTCCCATTCTTAGGCTCAATTATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU596850 True 278 lncRNA 0.47 1 456784 457061

Neighbor


gene id symbol gene type direction distance location
CI01000364_00400175_00427556 NA coding upstream 29208 399374 ~ 427576 (+)
CI01000364_00382475_00385399 NA coding upstream 70667 382475 ~ 386117 (+)
CI01000364_00294611_00295771 NA coding upstream 160834 294401 ~ 295950 (+)
CI01000364_00287825_00289294 NA coding upstream 165712 287047 ~ 291072 (+)
CI01000364_00263052_00264410 NA coding upstream 192037 262985 ~ 264747 (+)
CI01000364_00458726_00460323 NA coding downstream 1665 458726 ~ 461629 (+)
CI01000364_00471523_00472629 NA coding downstream 14462 471523 ~ 472821 (+)
CI01000364_00512592_00513897 NA coding downstream 54770 511831 ~ 514181 (+)
G520244 NA non-coding upstream 10007 446461 ~ 446777 (+)
G520222 NA non-coding upstream 31076 425438 ~ 425708 (+)
G520208 NA non-coding upstream 79815 376701 ~ 376969 (+)
G520207 NA non-coding upstream 80456 375697 ~ 376328 (+)
G520257 NA non-coding downstream 4958 462019 ~ 462225 (+)
G520258 NA non-coding downstream 5511 462572 ~ 463344 (+)
G520260 NA non-coding downstream 6684 463745 ~ 464082 (+)
G520013 NA other upstream 119677 309368 ~ 337107 (+)
G520009 NA other upstream 132553 241321 ~ 324231 (+)
G520012 NA other upstream 201778 250300 ~ 255006 (+)
CI01000364_00151094_00203772 NA other upstream 271741 150818 ~ 203857 (+)
G520007 NA other upstream 410938 44426 ~ 45846 (+)

Expression



Co-expression Network