Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G520263

Basic Information

Item	Value
gene id	G520263
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000364
NCBI id	null
chromosome length	520240
location	468720 ~ 468944 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU596861
GTTTGAATAGCTTTGGCTGGACTGTAGGCAAGCATGCTCAACAAATAGGAATCAGTAATATTGATATTAGCCCCACGGTGGCTCTGCCAGTATATCCACCTTGGCTCTTCTCTATACCAACAGTTGATTTGCAAATATTGAAATTAATAAATGGAAACCAGAAATATGTTCCAAAGGAGATAGTAGTGCAGCAGCATTTAGATAGCCATTACTTTCAACTTTTAC

Function

GO:

id	name	namespace
GO:0016071	mRNA metabolic process	biological_process
GO:0000375	RNA splicing, via transesterification reactions	biological_process
GO:0000377	RNA splicing, via transesterification reactions with bulged adenosine as nucleophile	biological_process
GO:0006397	mRNA processing	biological_process
GO:0000398	mRNA splicing, via spliceosome	biological_process
GO:0016607	nuclear speck	cellular_component
GO:0005681	spliceosomal complex	cellular_component
GO:0005685	U1 snRNP	cellular_component

KEGG:

id	description
ko03040	Spliceosome

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU596861	True	225	lncRNA	0.38	1	468720	468944

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000364_00455879_00458332	NA	coding	downstream	10388	455879 ~ 458332 (-)
CI01000364_00391142_00398789	NA	coding	downstream	69790	390951 ~ 398930 (-)
CI01000364_00373309_00374559	NA	coding	downstream	94161	373309 ~ 374559 (-)
CI01000364_00110528_00118790	NA	coding	downstream	349930	110429 ~ 118790 (-)
CI01000364_00081223_00107594	NA	coding	downstream	360927	81180 ~ 107793 (-)
G520259	NA	non-coding	downstream	5492	462986 ~ 463228 (-)
G520248	NA	non-coding	downstream	17158	451033 ~ 451562 (-)
G520238	NA	non-coding	downstream	27069	441403 ~ 441651 (-)
G520221	NA	non-coding	downstream	43675	424723 ~ 425045 (-)
G520108	NA	non-coding	downstream	198134	250124 ~ 270995 (-)
G520283	NA	non-coding	upstream	25816	494760 ~ 495117 (-)

Expression

Co-expression Network