CI01157671_00000309_00000650 (CAV1)



Basic Information


Item Value
gene id CI01157671_00000309_00000650
gene name CAV1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01157671
NCBI id null
chromosome length 2917
location 309 ~ 749 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01157671_00000309_00000650.mRNA
GTGGACTTCGAGGACGTGATCGCTGAGCCTCCCGGCACCTACAGCTTCGATGGCGTGTGGAAAGCGAGCTTCACCACCTTCACAGTAACAAAGTACTGGTGCTACAGGCTGCTGACGGCCCTAGTGGGCATCCCGCTCGCCCTGCTATGGGGCATCTTCTTCGCCATCCTCTCCTTTATCCACATCTGGGCGATGGTGCCTTGCGTGAAGAGCTTCCTAATCGTGATCCACACTTTCAGTCGAATCTACTCCATCTGTGTGCACACCTTCTGCGACCCACTGTTCGAAGCCATAGGGAAGTGCTTCAGCAGTGTGCGGGTCACAACCACCAAGGTGGTGTAGGGACAGGGAGAAGGAAAAGAGTCAGAGGGATAGGGTGGGATGGGGGAATGGAAACCAATGTCCGATGCAGGGAGATAAATCACATGATAAACCTCTATA

Function


symbol description
cav1 Enables beta-catenin binding activity. Acts upstream of or within several processes, including animal organ development; regionalization; and regulation of defense response. Predicted to be located in Golgi membrane and plasma membrane. Predicted to be integral component of membrane. Predicted to be active in Golgi apparatus; cytoplasmic vesicle; and perinuclear region of cytoplasm. Predicted to be integral component of plasma membrane. Predicted to colocalize with caveola; focal adhesion; and sarcolemma. Is expressed in several structures, including cardiovascular system; ectoderm; integument; lateral line system; and tail bud. Human ortholog(s) of this gene implicated in several diseases, including breast cancer (multiple); lipodystrophy (multiple); primary open angle glaucoma; primary pulmonary hypertension; and systemic scleroderma (multiple). Orthologous to human CAV1 (caveolin 1).

GO:

id name namespace
GO:0050688 regulation of defense response to virus biological_process

KEGG:

id description
K06278 CAV1; caveolin 1

RNA


RNA id representative length rna type GC content exon number start site end site
CI01157671_00000309_00000650.mRNA True 441 mRNA 0.54 1 309 749

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_024024 cav1 coding NC_007136.7 CM002909.2 18563476 ~ 18577586 (+)