XLOC_014594 (si:dkey-211g8.6)


Basic Information

Item Value
gene id XLOC_014594
gene name si:dkey-211g8.6
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 10611788 ~ 10612774 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00028850
ATGGCCAGTTTGGACTACCAGCTCCTCTTGTCATTCTACATCCTTACCTTCTTGATCGGCCTCCCTGCCAACATCCTAGCCTTCATCACCTTCTGTCGGAAAGTTCACCGCAAGCCCACCCCCATCGACATCCTCCTGCTAAACCTGACAATATCCGACCTCATCTTCCTCGCAGTCCTGCCCTTCAAGATGAAGGAGGCCGTTGACCAAATGATCTGGAGACTTCCCTTTTACCTGTGCTCCATCAGCAGTTTTCTGTTCTTCTCCACCATCTACACCAGCACCTTATTTCTGACCGCGATTAGCATAGAGCGCTATCTAGGCGTCGCATTTCCAATCCGATATGCTTTGGGCCGCCGACCACGAAATGCTGTGATCGCCTGCTGCTTCCTCTGGCTTCTGGGATCTCTAAACCTCAGCATTGTTTACATCGTCCCATACATAGACTCGAGCGATAACTCCACCTACAGCAAGCTACAGCTCAATCCCCATGTGAGAAACTGCTACGATAACTTCACCTTAGAGCAGATGACCATTCTGCTTCCTGTTCGCCTGGAGCTTTTCCTCCTGCTTTTCTGTATACCCCTCCTCATCTGCTGCTTCTGCTACATCAACTTCATCCGAATCCTCTCCAACCTGCCCCATCTGGGACGGCGTCGCAGACTCAGAGCCATTGGGTTGGCGGTTGGGACACTCTTGGTTTTCACCATCTGCTTCAGCCCTTATAACATCTCACACGTGGTTGGTTTCATCCATCGGAATAGCGAAGGTTGGCGACACTTTGCTCTGCTATTCAGCACTCTGAATGCCTGTTTGGACCCCATCATTTTTTACTTTTCCTCGGCAGCGGTTCGCAGTGCCATCAAAGCATGTGTTGATGGTCTCAAAGAGAAGATGCACATTGTTAGATGCAGAACATGCTGTCCTGCTCAAACTTCCAAAACTGAGGCTTACAAGGAGACTAATCCACCGGTTGACCTGGGGTGA

Function

symbol description
si:dkey-211g8.6 Predicted to enable G protein-coupled receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Orthologous to several human genes including FFAR2 (free fatty acid receptor 2) and FFAR3 (free fatty acid receptor 3).

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0007165 signal transduction biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060503-813 Predicted to enable G protein-coupled receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Orthologous to several human genes including FFAR2 (free fatty acid receptor 2) and FFAR3 (free fatty acid receptor 3).

Ensembl:

ensembl_id ENSDARG00000063088

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00028850 True 987 mRNA 0.50 1 10611788 10612774

Neighbor

gene id symbol gene type direction distance location
XLOC_014593 lim2.4 coding downstream 57436 10537443 ~ 10554352 (-)
XLOC_014592 si:ch211-171h4.5 coding downstream 133559 10454305 ~ 10478229 (-)
XLOC_014591 il11b coding downstream 179654 10429810 ~ 10432134 (-)
XLOC_014590 si:ch211-171h4.3 coding downstream 186648 10415484 ~ 10425140 (-)
XLOC_014589 zgc:194578 coding downstream 216105 10375782 ~ 10395683 (-)
XLOC_014595 si:dkey-211g8.7 coding upstream 11870 10624644 ~ 10627752 (-)
XLOC_014596 si:dkey-211g8.9 coding upstream 17905 10630679 ~ 10631482 (-)
XLOC_014597 tekt2 coding upstream 23595 10636369 ~ 10648523 (-)
XLOC_014598 olah coding upstream 36650 10649424 ~ 10656796 (-)
XLOC_014599 slc9a3.1 coding upstream 79392 10692166 ~ 10730488 (-)
XLOC_014711 CR382300.3 misc upstream 9115916 19728690 ~ 19728755 (-)
XLOC_014581 BX950852.2 non-coding downstream 488441 10123233 ~ 10123347 (-)
XLOC_014580 BX950852.1 non-coding downstream 599174 10012498 ~ 10012614 (-)
XLOC_014578 NA non-coding downstream 704849 9904324 ~ 9906939 (-)
XLOC_014572 BX927218.2 non-coding downstream 928280 9676517 ~ 9683508 (-)
XLOC_014570 NA non-coding downstream 1002276 9594867 ~ 9609512 (-)
XLOC_014600 BX005424.1 non-coding upstream 92685 10705459 ~ 10705475 (-)
XLOC_014603 NA non-coding upstream 246348 10859122 ~ 10881508 (-)
XLOC_014611 FP074861.1 non-coding upstream 580475 11193249 ~ 11193363 (-)
XLOC_014612 NA non-coding upstream 606987 11219761 ~ 11227568 (-)
XLOC_014620 CR548625.1 non-coding upstream 1112722 11725496 ~ 11725631 (-)

Expression


Co-expression Network