XLOC_014763 (pimr76)


Basic Information

Item Value
gene id XLOC_014763
gene name pimr76
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 23488241 ~ 23489527 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00029162
GACATTCTGGACCAGTATGAACTCGGCAAGGAGATTGGAGAGGGAGGATTTGGCAGCGTCTATGAAGGGAAGCGCTTGGAGGATGGCCTTGAGGTGGCAGTAAAAATTGCCAGAAAGCCACCGAACATGAAATACATCAACATCGCTGGTCATCCTGAGCCCCTTCCTTTAGAGATTGGCCTGTTGATACTGGCTCATAGAGGCGGCAAGGTTCCAGAAATCATTGAGCTGCTGGACTGGCAGGACCAGCAGGATCGCACAAAGGAGTACTTCCCACCAGAGTACTACCTGGACGAAGAATACCATGCAGAACCATCCACTGTATGGTCTTTAGGAGTTCTGTTATTCCTGCTGCTGTGTCAACGATTTCCTGAAGTCACGGACACGCAGAGGATCGATGATGGAAACTGGACTGAGCCTGGATTGTCAGAAGAATGCTGTGACTTGATTCAAGCTCTCCTGCAGGAAAACCCAAGCCAGCGGATTCCTCTGGAAGAAATCATTCTCCATCAATGGTTTAAG

Function

symbol description
pimr76 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

GO:

id name namespace
GO:0043066 negative regulation of apoptotic process biological_process
GO:0006468 protein phosphorylation biological_process
GO:0007346 regulation of mitotic cell cycle biological_process
GO:0046777 protein autophosphorylation biological_process
GO:0005737 cytoplasm cellular_component
GO:0005524 ATP binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060503-495 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

Ensembl:

ensembl_id ENSDARG00000115706

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00029162 True 522 mRNA 0.49 5 23488241 23489527

Neighbor

gene id symbol gene type direction distance location
XLOC_014762 pimr80 coding downstream 17532 23468771 ~ 23470709 (-)
XLOC_014761 pimr82 coding downstream 35896 23450493 ~ 23452345 (-)
XLOC_014760 NA coding downstream 50841 23435958 ~ 23437400 (-)
XLOC_014759 pimr77 coding downstream 68899 23418078 ~ 23419342 (-)
XLOC_014758 NA coding downstream 76380 23410015 ~ 23411861 (-)
XLOC_014764 pimr79 coding upstream 35831 23525358 ~ 23526638 (-)
XLOC_014765 pimr75 coding upstream 59379 23548906 ~ 23550179 (-)
XLOC_014766 pimr83 coding upstream 84198 23573725 ~ 23576381 (-)
XLOC_014767 pimr85 coding upstream 102721 23592248 ~ 23594914 (-)
XLOC_014768 NA coding upstream 135586 23625113 ~ 23627929 (-)
XLOC_014711 CR382300.3 misc downstream 3759486 19728690 ~ 19728755 (-)
XLOC_014755 NA non-coding downstream 182521 23305162 ~ 23305720 (-)
XLOC_014754 NA non-coding downstream 200121 23285194 ~ 23288120 (-)
XLOC_014753 BX914202.1 non-coding downstream 268646 23219477 ~ 23219595 (-)
XLOC_014772 NA non-coding upstream 230742 23720269 ~ 23726829 (-)
XLOC_014773 NA non-coding upstream 243760 23733287 ~ 23734065 (-)
XLOC_014777 NA non-coding upstream 367585 23857112 ~ 23857592 (-)
XLOC_014781 NA non-coding upstream 504507 23994034 ~ 24063227 (-)

Expression


Co-expression Network