XLOC_015211


Basic Information

Item Value
gene id XLOC_015211
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 7647863 ~ 7654618 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00033236
TACAAGTAATTCAAAGCAAGTATTTGATAGTATAGCAAAATGAATGACACTTTCCACATATTTCAGAGCATGTCCAACACATTGGAGGGTCTTCTTCAAGAGGAAAAGGTCCTGAATGAGGGCATTGAGAGGACTCAAGCACATGTACTTTCTCTTAACAAAGACATCCTCTCTCAGGAGGAGAAAATCAACAGAGCCGTCAAACAGTGTGCCAAATATACCAAGGAAATCCGTTCTGGTAAACAGAGCACAGAGAAAACCTTTGAAGAACGCGACATTGAGCTGCGAGAACTCCGAGATTTTAACAAAAGCATAAATAAGATGCTTCTGGATGCCATGGAGGGGAATCCTGAACTGTCATCTATATTACAGATACACTTTACGCAGGCTGGCTTGTCTCTGCCCTCTCCTTCCTCCACACCATCTAGTCGTCTAAGCTCAAAGCCCAGCTCTGCCCGCAGTTCAGCTTCACTCCATCGATCCTCAAATCTATCAGCCAGCAGCAGTCCCAGAAGCCAATCTGTCTCATCCCCACAAATGAAGACTGTGGATCTGGGTCTCGGCCTCTCAGTCACATCCCCACGAGGATCTCAGCCATCCAGTGCTGGAAGCAGCAGAAGCAGCAGCAAGTGCAAGAGCCCGTAG

Function

GO:

id name namespace
GO:0070482 response to oxygen levels biological_process
GO:0036293 response to decreased oxygen levels biological_process
GO:0009259 ribonucleotide metabolic process biological_process
GO:0009260 ribonucleotide biosynthetic process biological_process
GO:1902600 proton transmembrane transport biological_process
GO:0006928 movement of cell or subcellular component biological_process
GO:0046034 ATP metabolic process biological_process
GO:0006935 chemotaxis biological_process
GO:0000902 cell morphogenesis biological_process
GO:0006091 generation of precursor metabolites and energy biological_process
GO:0000904 cell morphogenesis involved in differentiation biological_process
GO:0031290 retinal ganglion cell axon guidance biological_process
GO:1901293 nucleoside phosphate biosynthetic process biological_process
GO:0009060 aerobic respiration biological_process
GO:0048812 neuron projection morphogenesis biological_process
GO:0042773 ATP synthesis coupled electron transport biological_process
GO:0042775 mitochondrial ATP synthesis coupled electron transport biological_process
GO:0006119 oxidative phosphorylation biological_process
GO:0006120 mitochondrial electron transport, NADH to ubiquinone biological_process
GO:0043062 extracellular structure organization biological_process
GO:0030198 extracellular matrix organization biological_process
GO:0120039 plasma membrane bounded cell projection morphogenesis biological_process
GO:0022900 electron transport chain biological_process
GO:0022904 respiratory electron transport chain biological_process
GO:0098655 cation transmembrane transport biological_process
GO:0098660 inorganic ion transmembrane transport biological_process
GO:0098662 inorganic cation transmembrane transport biological_process
GO:0006163 purine nucleotide metabolic process biological_process
GO:0006164 purine nucleotide biosynthetic process biological_process
GO:0017144 drug metabolic process biological_process
GO:0048858 cell projection morphogenesis biological_process
GO:0009117 nucleotide metabolic process biological_process
GO:0009123 nucleoside monophosphate metabolic process biological_process
GO:0009124 nucleoside monophosphate biosynthetic process biological_process
GO:0009126 purine nucleoside monophosphate metabolic process biological_process
GO:0009127 purine nucleoside monophosphate biosynthetic process biological_process
GO:0032989 cellular component morphogenesis biological_process
GO:0032990 cell part morphogenesis biological_process
GO:0046390 ribose phosphate biosynthetic process biological_process
GO:0055086 nucleobase-containing small molecule metabolic process biological_process
GO:0031638 zymogen activation biological_process
GO:0019637 organophosphate metabolic process biological_process
GO:0006753 nucleoside phosphate metabolic process biological_process
GO:0006754 ATP biosynthetic process biological_process
GO:0009141 nucleoside triphosphate metabolic process biological_process
GO:0009142 nucleoside triphosphate biosynthetic process biological_process
GO:0009144 purine nucleoside triphosphate metabolic process biological_process
GO:0009145 purine nucleoside triphosphate biosynthetic process biological_process
GO:0009150 purine ribonucleotide metabolic process biological_process
GO:0015672 monovalent inorganic cation transport biological_process
GO:0044281 small molecule metabolic process biological_process
GO:0009152 purine ribonucleotide biosynthetic process biological_process
GO:0090407 organophosphate biosynthetic process biological_process
GO:1901135 carbohydrate derivative metabolic process biological_process
GO:1901137 carbohydrate derivative biosynthetic process biological_process
GO:0009156 ribonucleoside monophosphate biosynthetic process biological_process
GO:0040011 locomotion biological_process
GO:0072521 purine-containing compound metabolic process biological_process
GO:0072522 purine-containing compound biosynthetic process biological_process
GO:0009161 ribonucleoside monophosphate metabolic process biological_process
GO:0009165 nucleotide biosynthetic process biological_process
GO:0097485 neuron projection guidance biological_process
GO:0009167 purine ribonucleoside monophosphate metabolic process biological_process
GO:0009168 purine ribonucleoside monophosphate biosynthetic process biological_process
GO:0006793 phosphorus metabolic process biological_process
GO:0061564 axon development biological_process
GO:0006796 phosphate-containing compound metabolic process biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0048666 neuron development biological_process
GO:0048667 cell morphogenesis involved in neuron differentiation biological_process
GO:0015985 energy coupled proton transport, down electrochemical gradient biological_process
GO:0019693 ribose phosphate metabolic process biological_process
GO:0015986 ATP synthesis coupled proton transport biological_process
GO:0007409 axonogenesis biological_process
GO:0007411 axon guidance biological_process
GO:0009199 ribonucleoside triphosphate metabolic process biological_process
GO:0042330 taxis biological_process
GO:0009201 ribonucleoside triphosphate biosynthetic process biological_process
GO:0009205 purine ribonucleoside triphosphate metabolic process biological_process
GO:0009206 purine ribonucleoside triphosphate biosynthetic process biological_process
GO:0001666 response to hypoxia biological_process
GO:0031175 neuron projection development biological_process
GO:0045333 cellular respiration biological_process
GO:0098803 respiratory chain complex cellular_component
GO:0005743 mitochondrial inner membrane cellular_component
GO:0005746 mitochondrial respirasome cellular_component
GO:0005747 mitochondrial respiratory chain complex I cellular_component
GO:0005753 mitochondrial proton-transporting ATP synthase complex cellular_component
GO:0030964 NADH dehydrogenase complex cellular_component
GO:0044421 obsolete extracellular region part cellular_component
GO:0044429 obsolete mitochondrial part cellular_component
GO:0044444 obsolete cytoplasmic part cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0016469 proton-transporting two-sector ATPase complex cellular_component
GO:0044455 obsolete mitochondrial membrane part cellular_component
GO:0033177 proton-transporting two-sector ATPase complex, proton-transporting domain cellular_component
GO:0031012 extracellular matrix cellular_component
GO:0062023 collagen-containing extracellular matrix cellular_component
GO:0019866 organelle inner membrane cellular_component
GO:0070069 cytochrome complex cellular_component
GO:0005581 collagen trimer cellular_component
GO:0032991 protein-containing complex cellular_component
GO:1990204 oxidoreductase complex cellular_component
GO:0031090 organelle membrane cellular_component
GO:0045259 proton-transporting ATP synthase complex cellular_component
GO:0045261 proton-transporting ATP synthase complex, catalytic core F(1) cellular_component
GO:0045263 proton-transporting ATP synthase complex, coupling factor F(o) cellular_component
GO:0045271 respiratory chain complex I cellular_component
GO:0045277 respiratory chain complex IV cellular_component
GO:0031966 mitochondrial membrane cellular_component
GO:0031967 organelle envelope cellular_component
GO:0031975 envelope cellular_component
GO:0000275 mitochondrial proton-transporting ATP synthase complex, catalytic sector F(1) cellular_component
GO:0000276 mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) cellular_component
GO:0070469 respirasome cellular_component
GO:0098796 membrane protein complex cellular_component
GO:0098798 mitochondrial protein-containing complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005739 mitochondrion cellular_component
GO:0098800 inner mitochondrial membrane protein complex cellular_component
GO:0005740 mitochondrial envelope cellular_component
GO:0008137 NADH dehydrogenase (ubiquinone) activity molecular_function
GO:0009055 electron transfer activity molecular_function
GO:0003954 NADH dehydrogenase activity molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0050136 NADH dehydrogenase (quinone) activity molecular_function
GO:0044769 ATPase activity, coupled to transmembrane movement of ions, rotational mechanism molecular_function
GO:0022890 inorganic cation transmembrane transporter activity molecular_function
GO:0015002 heme-copper terminal oxidase activity molecular_function
GO:0005198 structural molecule activity molecular_function
GO:0046933 proton-transporting ATP synthase activity, rotational mechanism molecular_function
GO:0005201 extracellular matrix structural constituent molecular_function
GO:0015318 inorganic molecular entity transmembrane transporter activity molecular_function
GO:0015075 ion transmembrane transporter activity molecular_function
GO:0015077 monovalent inorganic cation transmembrane transporter activity molecular_function
GO:0015078 proton transmembrane transporter activity molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function
GO:0016651 oxidoreductase activity, acting on NAD(P)H molecular_function
GO:0016655 oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function
GO:0016675 oxidoreductase activity, acting on a heme group of donors molecular_function
GO:0016676 oxidoreductase activity, acting on a heme group of donors, oxygen as acceptor molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00033236 True 645 lncRNA 0.47 4 7647863 7654618
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_015210 NA coding upstream 33803 7613166 ~ 7614060 (+)
XLOC_015209 ripk2 coding upstream 60203 7557912 ~ 7587660 (+)
XLOC_015208 NA coding upstream 118806 7526842 ~ 7529057 (+)
XLOC_015207 NA coding upstream 133682 7511477 ~ 7514181 (+)
XLOC_015205 si:dkeyp-106c3.1 coding upstream 235282 7295515 ~ 7412581 (+)
XLOC_015212 NA coding downstream 2680 7657298 ~ 7662101 (+)
XLOC_015213 NA coding downstream 61174 7715792 ~ 7727248 (+)
XLOC_015214 CT027646.3 coding downstream 66321 7720939 ~ 7721009 (+)
XLOC_015215 SNORA81 coding downstream 66594 7721212 ~ 7721390 (+)
XLOC_015216 CT027646.4 coding downstream 68776 7723394 ~ 7723583 (+)
XLOC_015206 CU929374.1 non-coding upstream 252955 7394790 ~ 7394908 (+)
XLOC_015203 NA non-coding upstream 384652 7261348 ~ 7263211 (+)

Expression

Expression of XLOC_015211 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Expression of XLOC_015211 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network