XLOC_015214 (CT027646.3)


Basic Information

Item Value
gene id XLOC_015214
gene name CT027646.3
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 7720939 ~ 7721009 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00030533
GTATGAAGTGATGGCATCATCTTTCGGGACTGACCTGTTATGGAGATAATCACTAATTTAACTGATCATAC

Function

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000083056

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00030533 True 71 snoRNA 0.38 1 7720939 7721009
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_015212 NA coding upstream 58838 7657298 ~ 7662101 (+)
XLOC_015211 NA coding upstream 66321 7647863 ~ 7654618 (+)
XLOC_015210 NA coding upstream 106879 7613166 ~ 7614060 (+)
XLOC_015209 ripk2 coding upstream 133279 7557912 ~ 7587660 (+)
XLOC_015208 NA coding upstream 191882 7526842 ~ 7529057 (+)
XLOC_015215 SNORA81 coding downstream 203 7721212 ~ 7721390 (+)
XLOC_015216 CT027646.4 coding downstream 2385 7723394 ~ 7723583 (+)
XLOC_015217 CT027646.1 coding downstream 2861 7723870 ~ 7723941 (+)
XLOC_015218 NA coding downstream 42898 7763907 ~ 7768273 (+)
XLOC_015219 kcnmb2 coding downstream 97359 7818368 ~ 7829400 (+)
XLOC_015207 NA non-coding upstream 206758 7511477 ~ 7514181 (+)
XLOC_015223 BX248229.1 non-coding downstream 468276 8189285 ~ 8189400 (+)

Expression

Expression of XLOC_015214(CT027646.3) in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Expression of XLOC_015214(CT027646.3) in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network