XLOC_015217 (CT027646.1)


Basic Information

Item Value
gene id XLOC_015217
gene name CT027646.1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 7723870 ~ 7723941 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00030536
GTATGAAGTGATGCACGTCATCTTTCGGGACTGACCTCTCATGGAGAGAACATTTCGACTTACTGATCATAC

Function

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000080523

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00030536 True 72 snoRNA 0.44 1 7723870 7723941
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_015216 CT027646.4 coding upstream 287 7723394 ~ 7723583 (+)
XLOC_015215 SNORA81 coding upstream 2480 7721212 ~ 7721390 (+)
XLOC_015214 CT027646.3 coding upstream 2861 7720939 ~ 7721009 (+)
XLOC_015212 NA coding upstream 61769 7657298 ~ 7662101 (+)
XLOC_015211 NA coding upstream 69252 7647863 ~ 7654618 (+)
XLOC_015218 NA coding downstream 39966 7763907 ~ 7768273 (+)
XLOC_015219 kcnmb2 coding downstream 94427 7818368 ~ 7829400 (+)
XLOC_015220 si:ch211-38m6.6 coding downstream 123539 7847480 ~ 7874384 (+)
XLOC_015221 pcolce2a coding downstream 307293 8031234 ~ 8050498 (+)
XLOC_015222 chst2a coding downstream 388508 8112449 ~ 8114608 (+)
XLOC_015223 BX248229.1 non-coding downstream 465344 8189285 ~ 8189400 (+)
XLOC_015225 NA non-coding downstream 760453 8484394 ~ 8488138 (+)
XLOC_015227 NA non-coding downstream 966717 8690658 ~ 8691029 (+)
XLOC_015231 NA non-coding downstream 1408644 9132585 ~ 9330209 (+)

Expression

Expression of XLOC_015217(CT027646.1) in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Expression of XLOC_015217(CT027646.1) in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network