XLOC_015245 (insl5b)


Basic Information

Item Value
gene id XLOC_015245
gene name insl5b
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 10127762 ~ 10129061 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00030584
AAGCTTACAAAAGGTTTGGGCAGTAGACTTTTCTTACTCTTTCCAGTCATGAAGGTGATGCTGCTAGCAGTGCTGTTGGTGTTTGCTGCATGTGCAGATTCGGCTCAGGCACAGAAAGGTCTCCGACTCTGTGGCCGTGAGTTTTTTCGGGCCGTCGTCTACACGTGTGGGGGCTCCAGATGGAGGCGGGTCCAAACTGAAGACCCCGTAAATGGTTATGAAATCGAGGCTGATGTGGAGTCACTAACCTCTGCAGAAATGGACCGAGAAAGAAGAGAGGTGTACGAAACGCTGCCTTCCACCTGCTGTAAAGTGGGCTGTAGAAAAAGCGATCTAGTTCGCATGTGCTGAGAAGCACAGGACTCCAGCACTTT

Function

symbol description
insl5b Predicted to enable G protein-coupled receptor binding activity. Predicted to be located in extracellular region. Is expressed in several structures, including enteroendocrine cell; female organism; gonad; gut; and male organism. Orthologous to human INSL5 (insulin like 5).

GO:

id name namespace
GO:0005576 extracellular region cellular_component
GO:0005179 hormone activity molecular_function
GO:0001664 G protein-coupled receptor binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070122-5 Predicted to enable G protein-coupled receptor binding activity. Predicted to be located in extracellular region. Is expressed in several structures, including enteroendocrine cell; female organism; gonad; gut; and male organism. Orthologous to human INSL5 (insulin like 5).

Ensembl:

ensembl_id ENSDARG00000069294

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00030584 True 374 mRNA 0.51 2 10127762 10129061
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_015244 cmpk coding upstream 50833 10063747 ~ 10076929 (+)
XLOC_015243 slc35a3b coding upstream 87498 9990491 ~ 10040264 (+)
XLOC_015242 sec22ba coding upstream 144101 9970942 ~ 9983661 (+)
XLOC_015241 tsen15 coding upstream 169957 9946121 ~ 9957805 (+)
XLOC_015240 CR956623.1 coding upstream 186357 9918678 ~ 9941405 (+)
XLOC_015246 ahsg2 coding downstream 5284 10134345 ~ 10141741 (+)
XLOC_015247 pfn2l coding downstream 17968 10147029 ~ 10151839 (+)
XLOC_015248 nsun4 coding downstream 31423 10160484 ~ 10169433 (+)
XLOC_015249 FO704816.1 coding downstream 76940 10206001 ~ 10206118 (+)
XLOC_015250 gadd45aa coding downstream 151584 10280645 ~ 10284572 (+)
XLOC_015239 BX470264.2 non-coding upstream 252117 9875529 ~ 9875645 (+)
XLOC_015236 NA non-coding upstream 470715 9651716 ~ 9657047 (+)
XLOC_015231 NA non-coding upstream 797553 9132585 ~ 9330209 (+)
XLOC_015232 NA non-coding upstream 809483 9316319 ~ 9318279 (+)
XLOC_015227 NA non-coding upstream 1436733 8690658 ~ 8691029 (+)
XLOC_015251 NA non-coding downstream 155700 10284761 ~ 10285629 (+)
XLOC_015252 BX927121.1 non-coding downstream 257418 10386479 ~ 10416272 (+)
XLOC_015253 NA non-coding downstream 434438 10563499 ~ 10564386 (+)
XLOC_015254 NA non-coding downstream 475452 10604513 ~ 10607329 (+)

Expression

Expression of XLOC_015245(insl5b) in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Expression of XLOC_015245(insl5b) in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000004_01773383_01774888 INSL5B misc CI01000004 null 1772928 ~ 1774942 (-)