XLOC_015641 (traj3)


Basic Information

Item Value
gene id XLOC_015641
gene name traj3
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 36096728 ~ 36096787 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00031214
TGGATGCAAATACTAACAAGATGATTTTTGGCAGTGGAACAAAGCTGTTTGTTGAACCAG

Function

symbol description
traj3 Predicted to be involved in adaptive immune response. Predicted to be part of T cell receptor complex.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000101058

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00031214 True 60 TR_J_gene 0.38 1 36096728 36096787

Neighbor

gene id symbol gene type direction distance location
XLOC_015640 si:dkey-161l11.75 coding upstream 299 36096367 ~ 36096429 (+)
XLOC_015639 traj2 coding upstream 761 36095905 ~ 36095967 (+)
XLOC_015638 si:dkey-161l11.74 coding upstream 1263 36095406 ~ 36095465 (+)
XLOC_015637 si:dkey-161l11.67 coding upstream 1672 36094994 ~ 36095056 (+)
XLOC_015636 BX681417.2 coding upstream 2409 36092953 ~ 36094319 (+)
XLOC_015642 traj4 coding downstream 627 36097414 ~ 36097469 (+)
XLOC_015643 traj5 coding downstream 1197 36097984 ~ 36098047 (+)
XLOC_015644 si:dkey-161l11.62 coding downstream 1554 36098341 ~ 36098397 (+)
XLOC_015645 traj6 coding downstream 1963 36098750 ~ 36098812 (+)
XLOC_015646 BX681417.3 coding downstream 2182 36098969 ~ 36099028 (+)
XLOC_015626 BX571812.1 non-coding upstream 265283 35831329 ~ 35831445 (+)
XLOC_015623 NA non-coding upstream 482430 35612555 ~ 35614298 (+)
XLOC_015619 FP236741.1 non-coding upstream 515437 35512002 ~ 35581291 (+)
XLOC_015618 NA non-coding upstream 593795 35482156 ~ 35502933 (+)
XLOC_015685 BX681417.1 non-coding downstream 20607 36117394 ~ 36117456 (+)
XLOC_015702 NA non-coding downstream 83456 36180243 ~ 36583275 (+)
XLOC_015703 NA non-coding downstream 148135 36244922 ~ 36247469 (+)
XLOC_015704 NA non-coding downstream 282452 36379239 ~ 36471110 (+)

Expression


Co-expression Network