XLOC_015654 (traj31)



Basic Information


Item Value
gene id XLOC_015654
gene name traj31
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 36102608 ~ 36102670 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence


>TCONS_00031227
TGAATAGAGCCGGCATGGAAAAGCTTATATTTGGGAAAGGCACACAATTACTCATTGAAACAA

Function


symbol description
traj31 Predicted to be involved in adaptive immune response. Predicted to be located in plasma membrane.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000110102

RNA


RNA id representative length rna type GC content exon number start site end site
TCONS_00031227 True 63 TR_J_gene 0.38 1 36102608 36102670

Neighbor


gene id symbol gene type direction distance location
XLOC_015653 traj11 coding upstream 485 36102061 ~ 36102123 (+)
XLOC_015652 BX681417.10 coding upstream 784 36101762 ~ 36101824 (+)
XLOC_015651 BX681417.16 coding upstream 1166 36101377 ~ 36101442 (+)
XLOC_015650 BX681417.17 coding upstream 2081 36100465 ~ 36100527 (+)
XLOC_015649 traj7 coding upstream 2339 36100207 ~ 36100269 (+)
XLOC_015655 BX681417.7 coding downstream 184 36102854 ~ 36102916 (+)
XLOC_015656 CT867973.1 coding downstream 639 36103309 ~ 36157913 (+)
XLOC_015657 traj15 coding downstream 1261 36103931 ~ 36103993 (+)
XLOC_015658 BX681417.9 coding downstream 1491 36104161 ~ 36104223 (+)
XLOC_015659 BX681417.22 coding downstream 1899 36104569 ~ 36104634 (+)
XLOC_015646 BX681417.3 non-coding upstream 3580 36098969 ~ 36099028 (+)
XLOC_015636 BX681417.2 non-coding upstream 8289 36092953 ~ 36094319 (+)
XLOC_015626 BX571812.1 non-coding upstream 271163 35831329 ~ 35831445 (+)
XLOC_015623 NA non-coding upstream 488310 35612555 ~ 35614298 (+)
XLOC_015619 FP236741.1 non-coding upstream 521317 35512002 ~ 35581291 (+)
XLOC_015685 BX681417.1 non-coding downstream 14724 36117394 ~ 36117456 (+)
XLOC_015702 NA non-coding downstream 77573 36180243 ~ 36583275 (+)
XLOC_015703 NA non-coding downstream 142252 36244922 ~ 36247469 (+)
XLOC_015704 NA non-coding downstream 276569 36379239 ~ 36471110 (+)
XLOC_015705 NA non-coding downstream 450022 36552692 ~ 36564473 (+)

Expression



Co-expression Network