trnah-gug



Basic Information


Item Value
gene id trnah-gug
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 31667504 ~ 31667575 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnah-gug
gccgtgatcgtatagtggttagtactctgcgttgtggccgcagcaaccccggttcgaatccgggtcacggca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnah-gug True 72 mRNA 0.58 1 31667504 31667575
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521202 LOC105025677 coding upstream 5357 31639629 ~ 31662147 (+)
LOC110532186 LOC106561197 coding upstream 69282 31597365 ~ 31598222 (+)
LOC110521117 LOC106573496 coding upstream 104233 31553090 ~ 31563271 (+)
rcn2 rcn2 coding upstream 115511 31549411 ~ 31551993 (+)
LOC110521096 isl2 coding upstream 205779 31455063 ~ 31461725 (+)
LOC110521218 LOC106573489 coding downstream 1081 31668656 ~ 31782195 (+)
LOC110520271 LOC106573485 coding downstream 296989 31964564 ~ 31966876 (+)
LOC110521263 idhp coding downstream 312710 31980285 ~ 31989249 (+)
LOC110521304 LOC106573467 coding downstream 431634 32099209 ~ 32204312 (+)
zgc:162879 LOC106573468 coding downstream 536900 32204475 ~ 32215553 (+)
G32639 LOC106573492 non-coding upstream 52282 31612869 ~ 31615222 (+)
G32614 NA non-coding upstream 102376 31564896 ~ 31565128 (+)
G32594 NA non-coding upstream 142407 31524788 ~ 31525097 (+)
G32364 NA non-coding upstream 502922 31163593 ~ 31164582 (+)
G32680 NA non-coding downstream 24324 31691899 ~ 31692161 (+)
G32747 NA non-coding downstream 130336 31797911 ~ 31798189 (+)
G32748 NA non-coding downstream 130809 31798384 ~ 31799031 (+)
G32774 LOC106561174 non-coding downstream 164634 31832209 ~ 31832632 (+)
G33247 NA non-coding downstream 181166 31848741 ~ 31848975 (+)
mef2aa mef2a other upstream 2414286 29188958 ~ 29316547 (+)
LOC110520661 LOC106573762 other upstream 2599709 28903691 ~ 29067795 (+)
G28416 carmil2 other upstream 3619142 28047626 ~ 28048362 (+)
G28285 LOC106573733 other upstream 3812550 27853757 ~ 27854954 (+)
G28280 NA other upstream 3822493 27844640 ~ 27845011 (+)
G33249 NA other downstream 182898 31850473 ~ 31850969 (+)
G33284 NA other downstream 288955 31956530 ~ 31961547 (+)
G33681 LOC106573476 other downstream 783279 32450854 ~ 32452385 (+)
G33768 NA other downstream 945498 32613073 ~ 32617684 (+)
sema3e LOC106573450 other downstream 1655192 33268524 ~ 33326523 (+)

Expression


trnah-gug Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network