odf3b (odf3b)



Basic Information


Item Value
gene id odf3b
gene name odf3b
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 35286541 ~ 35287452 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XM_036989454.1
TATGCCCCTGCCTCCTCCCTGTCTGCTTGGAGCAAAGGCTTCCACAACGACCAGACCCCAGGCCCTGCTGCTTACATGCAGCCCTCTGTGCTGGGGCCTGCCACCGTCAACAAAACCTCCACCCCTAACTTCTCCCGCCGAGGATGCAGCAAGATGGTCAGTTTCCACGAGGACCTGCAGAAGGTCTCTGGCCCAGGGACATTCAGAGTGGTGGACCCCTGCACCTACAAACAAAAGCCCCCCCACTACAGCATGACAGGATGCAACAGCATGCCTGGAGACACCACCATGAAACGGCCCGGAGCTCACCACCCTGAACAGGTGACCTTCACCAGGATCAAACCTCCAAGCTTCACTTTCAAAATTCATCATTCCGAGTTCATCGCTCCACTCATCGTGGACGTGGTGTAA

Function


symbol description
odf3b Predicted to be located in cytoplasm. Predicted to be active in cytoskeleton. Is expressed in peripheral olfactory organ; pronephros; and testis. Orthologous to human ODF3 (outer dense fiber of sperm tails 3) and ODF3B (outer dense fiber of sperm tails 3B).

NR:

description
PREDICTED: outer dense fiber protein 3B

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XM_036989454.1 True 411 mRNA 0.57 5 35286541 35287452

Neighbor


gene id symbol gene type direction distance location
LOC110521966 rabl2a coding downstream 724 35281285 ~ 35285817 (-)
LOC118947385 NA coding downstream 418246 34856461 ~ 34868295 (-)
zp2.3 zp2.3 coding downstream 595582 34686750 ~ 34690959 (-)
LOC110521923 LOC106573414 coding downstream 622070 34659087 ~ 34664471 (-)
cpt1 cpt1 coding downstream 626388 34647385 ~ 34660153 (-)
LOC110520384 LOC106573404 coding upstream 26501 35313953 ~ 35316192 (-)
LOC110532260 NA coding upstream 147343 35433794 ~ 35694776 (-)
LOC110522006 LOC106573384 coding upstream 455198 35742650 ~ 35749599 (-)
LOC110521997 LOC100196677 coding upstream 462853 35750305 ~ 35753348 (-)
LOC110522154 LOC105022174 coding upstream 605055 35892507 ~ 35914512 (-)
G37196 NA non-coding downstream 175246 35110630 ~ 35111295 (-)
G37184 NA non-coding downstream 195166 35091116 ~ 35091375 (-)
G37181 NA non-coding downstream 201315 35084985 ~ 35085226 (-)
G37180 NA non-coding downstream 201621 35084576 ~ 35084920 (-)
G37178 NA non-coding downstream 203566 35082632 ~ 35082975 (-)
G37322 NA non-coding upstream 11881 35299333 ~ 35299619 (-)
G37323 NA non-coding upstream 12726 35300178 ~ 35300431 (-)
G37329 NA non-coding upstream 25367 35312819 ~ 35313055 (-)
G37901 NA non-coding upstream 136788 35424240 ~ 35424504 (-)
G37310 LOC106573403 other downstream 8536 35273709 ~ 35278005 (-)
G36196 NA other downstream 905309 34341562 ~ 34381232 (-)
G36141 NA other downstream 923805 34277700 ~ 34362736 (-)
G35628 NA other downstream 1418496 33867558 ~ 33868045 (-)
G35299 NA other downstream 1834128 33442368 ~ 33452413 (-)
G37907 NA other upstream 153466 35440918 ~ 35441328 (-)
G37976 NA other upstream 295840 35583292 ~ 35583608 (-)
G38045 LOC106573386 other upstream 433988 35721440 ~ 35722056 (-)
LOC110522187 LOC106573361 other upstream 1082642 36370091 ~ 36409064 (-)
G38855 NA other upstream 1221086 36508538 ~ 36510829 (-)

Expression



Co-expression Network